ID: 1112164582

View in Genome Browser
Species Human (GRCh38)
Location 13:96904497-96904519
Sequence CAGTAGCTCTGCAGGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112164577_1112164582 12 Left 1112164577 13:96904462-96904484 CCACCTGGAGATATATTCAAATG No data
Right 1112164582 13:96904497-96904519 CAGTAGCTCTGCAGGGAAGAGGG No data
1112164578_1112164582 9 Left 1112164578 13:96904465-96904487 CCTGGAGATATATTCAAATGCAG No data
Right 1112164582 13:96904497-96904519 CAGTAGCTCTGCAGGGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112164582 Original CRISPR CAGTAGCTCTGCAGGGAAGA GGG Intergenic
No off target data available for this crispr