ID: 1112169068

View in Genome Browser
Species Human (GRCh38)
Location 13:96950950-96950972
Sequence CAACTAAGGTAGTGCCAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112169063_1112169068 18 Left 1112169063 13:96950909-96950931 CCTTAAAACAATGAAATAGTACA No data
Right 1112169068 13:96950950-96950972 CAACTAAGGTAGTGCCAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112169068 Original CRISPR CAACTAAGGTAGTGCCAGAG TGG Intergenic
No off target data available for this crispr