ID: 1112170740

View in Genome Browser
Species Human (GRCh38)
Location 13:96969475-96969497
Sequence GCCCCTATTACATGTAAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112170737_1112170740 -8 Left 1112170737 13:96969460-96969482 CCTGATCCCAAGGATGCCCCTAT No data
Right 1112170740 13:96969475-96969497 GCCCCTATTACATGTAAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112170740 Original CRISPR GCCCCTATTACATGTAAAGA AGG Intergenic
No off target data available for this crispr