ID: 1112173174

View in Genome Browser
Species Human (GRCh38)
Location 13:96994408-96994430
Sequence ACTTGCTCGCTGGGCCTCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 73}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112173174_1112173180 11 Left 1112173174 13:96994408-96994430 CCTCCGAGGCCCAGCGAGCAAGT 0: 1
1: 0
2: 0
3: 2
4: 73
Right 1112173180 13:96994442-96994464 GGTCCTCGCCCCGAGCAGCCTGG 0: 1
1: 0
2: 1
3: 6
4: 119
1112173174_1112173179 -10 Left 1112173174 13:96994408-96994430 CCTCCGAGGCCCAGCGAGCAAGT 0: 1
1: 0
2: 0
3: 2
4: 73
Right 1112173179 13:96994421-96994443 GCGAGCAAGTGCGTGTTCTCGGG 0: 1
1: 0
2: 0
3: 0
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112173174 Original CRISPR ACTTGCTCGCTGGGCCTCGG AGG (reversed) Intronic
901637851 1:10678571-10678593 ACTCGCTCCCTGGGCCGCGCCGG + Intronic
906776467 1:48534238-48534260 AGTTGCTGGCTGGGCCCCGCAGG + Exonic
915001439 1:152597523-152597545 ACTTGGATGCTGGGCCTGGGTGG + Intronic
921949095 1:220910384-220910406 ACATGGGCGCTGGGCCTCAGAGG + Intergenic
923086527 1:230707073-230707095 ATTTGCACACTGGGCCTTGGGGG + Intronic
1062822754 10:547321-547343 AAGTGCTCGCTGGGCCTGGGAGG - Intronic
1070639764 10:78159329-78159351 ACTGGCTGCCTGGGACTCGGAGG - Intergenic
1078086599 11:8237164-8237186 ACTCACTCTCTGGGTCTCGGGGG + Intronic
1083554371 11:63614208-63614230 ACTTTCTCGCCGGGGCCCGGCGG + Exonic
1101737012 12:107470734-107470756 TCTGGCTGGCTGGGCCTCAGTGG + Intronic
1102536796 12:113587850-113587872 CCTTTCTCGCTGGGGCTCAGCGG - Intergenic
1103706894 12:122879820-122879842 ACTTGCTTGATTGGGCTCGGTGG + Intronic
1104920127 12:132286204-132286226 ACTTCCTCGGCGGGCGTCGGGGG + Intronic
1112173174 13:96994408-96994430 ACTTGCTCGCTGGGCCTCGGAGG - Intronic
1118761882 14:68885141-68885163 GCTTTCTCGTTGGGCCTCGAGGG - Intronic
1124218764 15:27831767-27831789 AGTGTCTAGCTGGGCCTCGGAGG - Intronic
1130371081 15:83285344-83285366 CTTTGCTCTCTGGGCCTCAGTGG + Intergenic
1134135953 16:11676427-11676449 ACTTGCTGGCATGGCCTCTGCGG + Exonic
1137617115 16:49855066-49855088 CCCTGCCCGGTGGGCCTCGGTGG + Intronic
1138240134 16:55420966-55420988 ACTTAATCTCTGGGCCTCTGTGG - Intronic
1138454983 16:57115980-57116002 ACTTCCTCTCTGGGTCTCAGGGG - Intronic
1142752800 17:1998516-1998538 ACCTGCGCGCTGGGCAGCGGTGG - Intronic
1143781850 17:9233275-9233297 ACTTGCAGGCTGGGCCCTGGGGG - Intronic
1146661250 17:34666420-34666442 CCCTGCTCGGTGGGCCTGGGCGG + Intergenic
1147470296 17:40652219-40652241 ATTTGCTCTCTGGGCTTCGATGG + Intergenic
1151884824 17:76917320-76917342 ACTTTCTTGTTGGGTCTCGGGGG + Intronic
1153508842 18:5831298-5831320 ACTTCCACTCTGGGCCTCAGAGG + Intergenic
1160595123 18:79968025-79968047 ACATCCTGGCTGTGCCTCGGCGG + Intronic
1164955115 19:32376531-32376553 CCTTGCCCCCTGGGCCTCTGTGG - Intronic
1165956975 19:39507191-39507213 TCCTGCGCGCTGGGCTTCGGCGG + Exonic
926222695 2:10946614-10946636 CCTTGCTCTCTGGGCCTCCGTGG - Intergenic
926224145 2:10955417-10955439 ACTAGCTGGCTGGGGCTGGGTGG - Intergenic
926327717 2:11799646-11799668 AATTCCTCCCTGGGCCTCAGTGG - Intronic
932337298 2:70938475-70938497 CAGTGCTCGCTGGGCCACGGTGG + Intronic
934686419 2:96325250-96325272 CCCTGCACGCTGGGCCACGGGGG + Intergenic
936858447 2:116987703-116987725 ACTTGCTCTCTGGGGCTTTGGGG + Intergenic
937956282 2:127423288-127423310 AATTGCTCGCTGGACAACGGCGG + Exonic
947767903 2:232649200-232649222 TCTTGCTAGCTGGCCCTGGGTGG + Intronic
948415121 2:237797528-237797550 ACTTGATTGTTGGGCCACGGAGG - Intronic
1172464587 20:35146768-35146790 TCTGACTCTCTGGGCCTCGGCGG - Intronic
1182269543 22:29144872-29144894 ACTTCCTCGGAGGGCCTGGGAGG + Intronic
1182690631 22:32159178-32159200 ACTTGCTGCCTGGGCCCCAGCGG - Exonic
1182749972 22:32633589-32633611 CCTTGCTCCCTCTGCCTCGGAGG - Intronic
950451525 3:13068176-13068198 ACATCCTCCCTGGGCCTCAGAGG - Intronic
953477140 3:43215155-43215177 GCTAGCTTGCTGGTCCTCGGAGG - Intergenic
954366906 3:50151193-50151215 ACTTGTTCCCTGGGCCTGGCAGG - Intergenic
954414695 3:50387522-50387544 ACCTCCTTGCTGGGCCTTGGTGG - Intronic
954717787 3:52534920-52534942 ACTTGCTCACTGGGGCCCTGGGG - Intronic
962325493 3:134428709-134428731 ACTTCCCTGCTGGGGCTCGGGGG - Intergenic
968669722 4:1842622-1842644 GCCTGCTCTCTGGCCCTCGGTGG - Intronic
970553844 4:17212009-17212031 ACTAGCTGGCTGGTCCTGGGAGG - Intergenic
971326905 4:25652212-25652234 GCTTGCTCACTGGTCCTCAGGGG + Intergenic
972183384 4:36497276-36497298 ACTTGCTCTATGGGTCTTGGTGG - Intergenic
974932622 4:68376260-68376282 ACGGGCTCGCTGGGACTTGGAGG - Intergenic
975984400 4:80189330-80189352 ACTTGCAAGCTGGGCATGGGAGG + Intronic
983212984 4:164977576-164977598 CCTTCCTCGCGGGGGCTCGGTGG - Exonic
992980431 5:82165223-82165245 TCTTGGTCCCTGGGCCTGGGTGG - Intronic
1000045097 5:157515896-157515918 CCTCGCTCCCTGGGCCTAGGTGG - Intronic
1007236785 6:40396261-40396283 ACTTACTAGCTGGGCCTCCTTGG - Intronic
1018902615 6:168058981-168059003 ACTTGCCCGCTGCGTCTCTGGGG + Intronic
1018946280 6:168348463-168348485 ACTTGCTCCCTGGCCCTTTGTGG - Intergenic
1021716924 7:23469586-23469608 CCCGGCACGCTGGGCCTCGGGGG - Intronic
1022518285 7:30989201-30989223 AAATGCCCGCAGGGCCTCGGGGG - Intronic
1022739652 7:33109109-33109131 GCCTGCTCGCGGGGGCTCGGAGG + Intronic
1036910578 8:12754698-12754720 ACCTGCTCGCAGCGCCTCGCAGG + Exonic
1049663937 8:143834825-143834847 AGCTGCTCCCTGGGCCTCTGAGG - Exonic
1053016448 9:34665049-34665071 ACTGGCTGGCTGGGCAGCGGCGG + Exonic
1053461858 9:38277630-38277652 ACTTTCTCACTGTGCCTCTGGGG - Intergenic
1056059611 9:82870488-82870510 ACATGCCCTCTGGGCTTCGGGGG + Intergenic
1057862263 9:98650273-98650295 ACTTGCTAGCTGGGTGACGGAGG + Intronic
1062502866 9:136858739-136858761 ACTGGCGTGCTGGGCCCCGGGGG + Exonic
1187413309 X:19069978-19070000 ACATGCCCTCTGGGGCTCGGGGG + Intronic
1188003483 X:25002537-25002559 ACTTGCGCCCTGGGCCGCGAGGG + Intergenic
1199574110 X:149296915-149296937 CCTTCCTCTCTGGGCCTCTGTGG + Intergenic
1199979971 X:152915456-152915478 ACTTCCCTGCTGGGCCTCCGTGG + Intronic
1200089026 X:153625793-153625815 ACTTCCCTGCTGGGCCTCTGGGG - Intergenic