ID: 1112175430 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 13:97018771-97018793 |
| Sequence | CAGGGTGAGCACAGGGCCCA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1112175430_1112175439 | 25 | Left | 1112175430 | 13:97018771-97018793 | CCCTGGGCCCTGTGCTCACCCTG | No data | ||
| Right | 1112175439 | 13:97018819-97018841 | TCCGGCAAGCCAGAAAAATGTGG | No data | ||||
| 1112175430_1112175438 | 7 | Left | 1112175430 | 13:97018771-97018793 | CCCTGGGCCCTGTGCTCACCCTG | No data | ||
| Right | 1112175438 | 13:97018801-97018823 | CAGGAATGTGCAAGCTCTTCCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1112175430 | Original CRISPR | CAGGGTGAGCACAGGGCCCA GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||