ID: 1112175430

View in Genome Browser
Species Human (GRCh38)
Location 13:97018771-97018793
Sequence CAGGGTGAGCACAGGGCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112175430_1112175439 25 Left 1112175430 13:97018771-97018793 CCCTGGGCCCTGTGCTCACCCTG No data
Right 1112175439 13:97018819-97018841 TCCGGCAAGCCAGAAAAATGTGG No data
1112175430_1112175438 7 Left 1112175430 13:97018771-97018793 CCCTGGGCCCTGTGCTCACCCTG No data
Right 1112175438 13:97018801-97018823 CAGGAATGTGCAAGCTCTTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112175430 Original CRISPR CAGGGTGAGCACAGGGCCCA GGG (reversed) Intergenic
No off target data available for this crispr