ID: 1112175438

View in Genome Browser
Species Human (GRCh38)
Location 13:97018801-97018823
Sequence CAGGAATGTGCAAGCTCTTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112175433_1112175438 0 Left 1112175433 13:97018778-97018800 CCCTGTGCTCACCCTGAAGGCAG No data
Right 1112175438 13:97018801-97018823 CAGGAATGTGCAAGCTCTTCCGG No data
1112175429_1112175438 17 Left 1112175429 13:97018761-97018783 CCAGACACAGCCCTGGGCCCTGT No data
Right 1112175438 13:97018801-97018823 CAGGAATGTGCAAGCTCTTCCGG No data
1112175431_1112175438 6 Left 1112175431 13:97018772-97018794 CCTGGGCCCTGTGCTCACCCTGA No data
Right 1112175438 13:97018801-97018823 CAGGAATGTGCAAGCTCTTCCGG No data
1112175430_1112175438 7 Left 1112175430 13:97018771-97018793 CCCTGGGCCCTGTGCTCACCCTG No data
Right 1112175438 13:97018801-97018823 CAGGAATGTGCAAGCTCTTCCGG No data
1112175434_1112175438 -1 Left 1112175434 13:97018779-97018801 CCTGTGCTCACCCTGAAGGCAGC No data
Right 1112175438 13:97018801-97018823 CAGGAATGTGCAAGCTCTTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112175438 Original CRISPR CAGGAATGTGCAAGCTCTTC CGG Intergenic
No off target data available for this crispr