ID: 1112175439

View in Genome Browser
Species Human (GRCh38)
Location 13:97018819-97018841
Sequence TCCGGCAAGCCAGAAAAATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112175430_1112175439 25 Left 1112175430 13:97018771-97018793 CCCTGGGCCCTGTGCTCACCCTG No data
Right 1112175439 13:97018819-97018841 TCCGGCAAGCCAGAAAAATGTGG No data
1112175433_1112175439 18 Left 1112175433 13:97018778-97018800 CCCTGTGCTCACCCTGAAGGCAG No data
Right 1112175439 13:97018819-97018841 TCCGGCAAGCCAGAAAAATGTGG No data
1112175434_1112175439 17 Left 1112175434 13:97018779-97018801 CCTGTGCTCACCCTGAAGGCAGC No data
Right 1112175439 13:97018819-97018841 TCCGGCAAGCCAGAAAAATGTGG No data
1112175431_1112175439 24 Left 1112175431 13:97018772-97018794 CCTGGGCCCTGTGCTCACCCTGA No data
Right 1112175439 13:97018819-97018841 TCCGGCAAGCCAGAAAAATGTGG No data
1112175437_1112175439 6 Left 1112175437 13:97018790-97018812 CCTGAAGGCAGCAGGAATGTGCA No data
Right 1112175439 13:97018819-97018841 TCCGGCAAGCCAGAAAAATGTGG No data
1112175436_1112175439 7 Left 1112175436 13:97018789-97018811 CCCTGAAGGCAGCAGGAATGTGC No data
Right 1112175439 13:97018819-97018841 TCCGGCAAGCCAGAAAAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112175439 Original CRISPR TCCGGCAAGCCAGAAAAATG TGG Intergenic
No off target data available for this crispr