ID: 1112179888

View in Genome Browser
Species Human (GRCh38)
Location 13:97068323-97068345
Sequence TGGGATTCCCCCTACCAGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112179882_1112179888 28 Left 1112179882 13:97068272-97068294 CCAGTATTTAAGTGGAATTTAAT No data
Right 1112179888 13:97068323-97068345 TGGGATTCCCCCTACCAGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112179888 Original CRISPR TGGGATTCCCCCTACCAGCG GGG Intergenic
No off target data available for this crispr