ID: 1112185387

View in Genome Browser
Species Human (GRCh38)
Location 13:97123570-97123592
Sequence CAGTTGACCGGGAGGCCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112185379_1112185387 -4 Left 1112185379 13:97123551-97123573 CCTGTGCCCTGCCTCAGACCAGT No data
Right 1112185387 13:97123570-97123592 CAGTTGACCGGGAGGCCCTGAGG No data
1112185380_1112185387 -10 Left 1112185380 13:97123557-97123579 CCCTGCCTCAGACCAGTTGACCG No data
Right 1112185387 13:97123570-97123592 CAGTTGACCGGGAGGCCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112185387 Original CRISPR CAGTTGACCGGGAGGCCCTG AGG Intergenic
No off target data available for this crispr