ID: 1112188126

View in Genome Browser
Species Human (GRCh38)
Location 13:97147690-97147712
Sequence GTGTAGGTATCCAGGAAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112188120_1112188126 22 Left 1112188120 13:97147645-97147667 CCTTAAAATCTAGGGAGGAAAGA No data
Right 1112188126 13:97147690-97147712 GTGTAGGTATCCAGGAAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112188126 Original CRISPR GTGTAGGTATCCAGGAAGGA TGG Intergenic
No off target data available for this crispr