ID: 1112195250

View in Genome Browser
Species Human (GRCh38)
Location 13:97219413-97219435
Sequence CAACTCAGGCTGCCATAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 2, 1: 1, 2: 2, 3: 11, 4: 102}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112195247_1112195250 16 Left 1112195247 13:97219374-97219396 CCTAAAAGCAATCTAAAGAGAGT 0: 1
1: 0
2: 2
3: 17
4: 253
Right 1112195250 13:97219413-97219435 CAACTCAGGCTGCCATAGACTGG 0: 2
1: 1
2: 2
3: 11
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112195250 Original CRISPR CAACTCAGGCTGCCATAGAC TGG Intergenic
902443777 1:16448555-16448577 GAACTCAGGCTGCCAGTGAGTGG + Intronic
905514578 1:38552848-38552870 CAGCTCAGGCTGCCATAAACTGG + Intergenic
911287815 1:96018827-96018849 CCACACAGGATGCCACAGACTGG + Intergenic
912947421 1:114096577-114096599 CACCTCAGCCTGCCAGAAACAGG + Intronic
916970982 1:170015835-170015857 CAACTCACCTTGTCATAGACAGG + Intronic
918568226 1:185955709-185955731 CAGCTCTGGCAGCCAAAGACAGG - Intronic
922994122 1:229942639-229942661 CCACGCAGGCTGCCAAAGACTGG - Intergenic
1062825763 10:567436-567458 CACCTCAGCCTCCCAAAGACAGG + Intronic
1066802885 10:39209580-39209602 CAAGTCAGGCTGCCAGATAGGGG - Intergenic
1068828467 10:61466198-61466220 CAACTCAGGCTGCCATAACAAGG - Intergenic
1069071516 10:63994669-63994691 CCACTCAGGCTGCCCAAGAATGG - Intergenic
1073107991 10:101043512-101043534 CAGCTCAGGCTGCCAGACAAAGG + Intergenic
1075062302 10:119265641-119265663 CAGCTCAGGCTGCCATAGACTGG - Intronic
1080310528 11:30886399-30886421 CTGCTCAGGCTGCCACAAACTGG + Intronic
1082008450 11:47434460-47434482 CAGCTCAGGCTGCCATAACAAGG - Intergenic
1083983389 11:66192701-66192723 CCACCCAGGCAGCCATAGAAAGG + Intronic
1086287637 11:85267358-85267380 CAAAACAGAATGCCATAGACTGG - Intronic
1088255157 11:107896630-107896652 CACCTCAGGCTTCCAAAGTCTGG - Intronic
1089739408 11:120571950-120571972 CAGCTCCAGCTGACATAGACAGG - Intronic
1090028337 11:123186332-123186354 CAACTTAGGCTGCCCCAGCCTGG - Intronic
1090483070 11:127085085-127085107 CAAGACAGGCTGCCACTGACGGG - Intergenic
1093876144 12:24351640-24351662 CAACTTAGGCTGCCGTGAACTGG - Intergenic
1096308143 12:50497027-50497049 CAAGTCAGGCTGCCAGATAGGGG - Intergenic
1108438262 13:50422666-50422688 GAACCCAGGCTCCCATGGACTGG + Intronic
1109201693 13:59438346-59438368 CAACTCAGGCTGCTAAAGATTGG + Intergenic
1112195250 13:97219413-97219435 CAACTCAGGCTGCCATAGACTGG + Intergenic
1121438317 14:93933164-93933186 CTACCCAGGCTGACATACACTGG - Intergenic
1124211508 15:27768744-27768766 CACCACAGGGTCCCATAGACAGG - Intronic
1126172139 15:45704091-45704113 GAACTCGGGCTCCCTTAGACTGG - Intergenic
1127331184 15:57941728-57941750 GAACTCTGGCTGCTAGAGACAGG - Intergenic
1128284512 15:66425169-66425191 AAAGTCTGGCTGCCATACACAGG - Intronic
1130651395 15:85764020-85764042 CAACTCAGGCAGCCGCAGACCGG - Intronic
1132215636 15:100059726-100059748 CAACCCAAGCTGCCACAGAAGGG - Intronic
1133119216 16:3596072-3596094 CGGCTGAGGCTGCCATGGACTGG - Intronic
1134537171 16:15035324-15035346 CCACTGAGCCTGCCACAGACTGG - Intronic
1136774188 16:32862867-32862889 CATCTCAGACTCCCAGAGACTGG - Intergenic
1136896423 16:33998647-33998669 CATCTCAGACTCCCAGAGACTGG + Intergenic
1140135870 16:72205030-72205052 CTACTCATTCTGCCATGGACAGG + Intergenic
1140192121 16:72826978-72827000 CAACAAAGGCTGCCCTAAACTGG + Intronic
1203076612 16_KI270728v1_random:1124986-1125008 CATCTCAGACTCCCAGAGACTGG - Intergenic
1145238925 17:21228261-21228283 CAACCCAGGCTGCTGTAGACAGG - Intergenic
1146802587 17:35838524-35838546 CAGCTAAGGCAGCCATTGACTGG + Exonic
1151578661 17:74965203-74965225 CAGCTCAGGCTGCCCTTGCCAGG + Intronic
1156294903 18:35780769-35780791 CAACTCTGTGTGCCATAGATGGG + Intergenic
1158716281 18:59882469-59882491 CAACTCAGGCTTCAAAAGAATGG - Intergenic
1160072542 18:75641183-75641205 CAACTCAGGCCTCCACAGCCAGG + Intergenic
1160137125 18:76281944-76281966 CCACTCAGACTGCCAAAGACTGG + Intergenic
1166110862 19:40622310-40622332 AAACTGAGGCTGGCATAGATAGG - Intronic
1166421673 19:42640832-42640854 CAACTCAGCCTCCTATACACAGG + Intronic
1168246847 19:55116895-55116917 CAGCACAGGCTGCCAAAGCCAGG + Intronic
1168605528 19:57756890-57756912 AAACTCAGGCTGGAATACACTGG + Exonic
925579381 2:5395150-5395172 ACACCCAGGATGCCATAGACAGG - Intergenic
926088122 2:10032802-10032824 TAACCCAGGCAGCCTTAGACAGG + Intergenic
926441661 2:12895455-12895477 CAGCTCAGGCTGGCAAATACAGG + Intergenic
926777791 2:16439334-16439356 CCACACAGGCTGCCCTAGAGAGG - Intergenic
927747913 2:25639577-25639599 AAATACAGGCTGCCACAGACTGG - Intronic
929770285 2:44885960-44885982 CAACTAAGGCTGCCACATGCAGG - Intergenic
931246420 2:60496267-60496289 CAACACAGGCTACCACAGATGGG + Intronic
932134738 2:69218448-69218470 CAACTCAGTGTGCCATAGCCAGG + Intronic
935601034 2:104921509-104921531 CAAGTCAGGCAGCCATACATGGG + Intergenic
935654706 2:105412175-105412197 CAGCCCAGGCTTCCATAGATAGG + Intronic
939620473 2:144412741-144412763 GAACTCAGGCTGAGATAGTCAGG - Intronic
940301489 2:152180288-152180310 CGAGTCAGGCTGCCATATAGGGG - Intergenic
940504144 2:154531285-154531307 CAACTCACTCTGCCATAGAGAGG + Intergenic
945140982 2:206685812-206685834 GAACTCATGCTGCCATATTCCGG - Intronic
948056064 2:235010100-235010122 CAAGTCAGGCTGCCAAGGAGGGG - Intronic
1170127728 20:12984668-12984690 CAATTCAGAATGCCATAGCCAGG - Intergenic
1170354825 20:15480575-15480597 GAACTCAGGCAGCCATCCACAGG - Intronic
1177407364 21:20687220-20687242 TAGCTCAGACTGCCATAAACTGG - Intergenic
1179040195 21:37796023-37796045 CCCCTCAGGCTCCCATAGAACGG - Intronic
1179721807 21:43320585-43320607 CATCTCAGGCTGCCAGAAGCTGG + Intergenic
1180218953 21:46345882-46345904 CAACTCAGGCTGCAACACAGAGG - Intronic
1182430859 22:30298178-30298200 AAAATCAGGCTGCCAGAGCCAGG - Intronic
1183106814 22:35620801-35620823 CAACTCAGGAGGCCAGAGACGGG - Intronic
950868503 3:16208993-16209015 CATCTCAGGTTGCCACACACTGG - Intronic
952255501 3:31691689-31691711 CAACTCAGGCTGGCATACAGTGG - Intronic
953436571 3:42881911-42881933 GAACCCAGGCTGCCATGGAGGGG - Intronic
954257892 3:49418979-49419001 CAACTGAGGCTGCCCTCCACAGG + Exonic
960187849 3:114665657-114665679 CAACTCAGGGTGTCTTACACAGG + Intronic
961524841 3:127490225-127490247 CTGCTCAGGCTGCCATAGACTGG - Intergenic
969275161 4:6129790-6129812 CAATTGAGGCTGCCAGAAACAGG - Intronic
972080320 4:35141555-35141577 CAAGTCAGGCTGCCAGATACGGG + Intergenic
973008551 4:45043865-45043887 CAAGTCAGGCTGCCAGATAGGGG + Intergenic
975114335 4:70662424-70662446 CAACCCAGATTCCCATAGACTGG - Intronic
976272788 4:83247846-83247868 CAACTGAGGCTGCCCTCCACAGG - Intergenic
977381336 4:96278188-96278210 CAATTCAGCCTCCTATAGACTGG + Intergenic
977398909 4:96507104-96507126 CTACTCATGCTGCTAAAGACTGG - Intergenic
979252726 4:118582221-118582243 CAACTCAGGCTGCCATAGACTGG + Intergenic
979271456 4:118767155-118767177 CAACTTAGGGCGCCAGAGACTGG - Intronic
993891317 5:93477983-93478005 CTCCTCAAGCTGGCATAGACTGG + Intergenic
993921346 5:93807987-93808009 CACATCAGGCTGCCTTGGACAGG + Intronic
1000469128 5:161617910-161617932 CACCTCAGTCTCCCAAAGACTGG - Intronic
1000497253 5:162000187-162000209 CATCTCAGGCTGACATTAACAGG - Intergenic
1000504593 5:162099516-162099538 CAACTCAGCCTCCCAAAGTCTGG + Intronic
1000881557 5:166703694-166703716 AAACTGAGGCTGCCTTAGGCAGG + Intergenic
1007378528 6:41471959-41471981 CAACTAAGGGAGCCGTAGACTGG - Intergenic
1011239499 6:85255936-85255958 TAGCTCAGGCTGACATAGGCTGG - Intergenic
1018533193 6:164789617-164789639 CAACTTAGTCTATCATAGACTGG + Intergenic
1022448040 7:30485960-30485982 TTACTCTGCCTGCCATAGACAGG - Intergenic
1025193901 7:56917773-56917795 CAACCCAGGCAGCCATCAACAGG + Intergenic
1028483709 7:91335645-91335667 CAACTAAGGCTCCAATAGAAAGG + Intergenic
1029894076 7:103963084-103963106 GAAACCAGGCTGCCTTAGACAGG + Intronic
1035862089 8:3039736-3039758 TAACTCAAGTTGCTATAGACAGG - Intronic
1036579572 8:10061477-10061499 CAACGCAAGATGCCATAGAAAGG - Intronic
1037461829 8:19118253-19118275 TAACTCAGGCACCCTTAGACTGG + Intergenic
1040704286 8:50106904-50106926 CAATTCATACTGCCATAAACAGG + Intronic
1041480676 8:58316532-58316554 CAACTTAGGCTGCCATTTTCAGG + Intergenic
1045742260 8:105375130-105375152 CTATCCAGGCTGCCATGGACTGG - Intronic
1045822471 8:106356345-106356367 GAAGTCAGGAGGCCATAGACAGG + Intronic
1047562925 8:126008856-126008878 CAAGTCAGGCCGCCAGAGAGGGG + Intergenic
1053105647 9:35405736-35405758 GGACTGAGGCTGCCACAGACAGG + Intergenic
1060056151 9:120414886-120414908 CAATTCAGGATGCCAGAGGCTGG + Intronic
1187297418 X:18015309-18015331 CCATTCATGCTGCTATAGACTGG - Intergenic
1188835893 X:34953791-34953813 CAACTCAGCCTCCCAAAGGCTGG + Intergenic
1191615107 X:63162387-63162409 AAACTCAGGCTGCCACAGCTGGG + Intergenic
1191621191 X:63216536-63216558 AAACTCAGGCTGCCACAGCTGGG - Intergenic
1193862798 X:86691778-86691800 TAGCTAAGGCTGCCACAGACAGG - Intronic
1200105771 X:153711205-153711227 CATCTCAGACTCCCAGAGACTGG + Intronic