ID: 1112195728

View in Genome Browser
Species Human (GRCh38)
Location 13:97224323-97224345
Sequence AGCACAGATGGCCCCAAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 262}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112195728 Original CRISPR AGCACAGATGGCCCCAAGCA GGG Intronic
900512062 1:3065485-3065507 TGCACACACGGCCCGAAGCAGGG + Intergenic
900869112 1:5289270-5289292 AGCACAGGTGGGGCCAGGCAAGG - Intergenic
903152800 1:21424457-21424479 AGCACAGGTGGCCACTGGCATGG + Intergenic
903160330 1:21483527-21483549 AGCACAGGTGGCCACTGGCATGG - Exonic
903339191 1:22643600-22643622 AGCAAGGATTGCCCAAAGCAGGG - Intergenic
904606634 1:31701496-31701518 AGCCCAGAGGGCACCCAGCAAGG + Intronic
910466583 1:87506795-87506817 AGCAGAGATTGCCATAAGCAGGG - Intergenic
914898512 1:151697981-151698003 AGAGCAGAGGGCCCAAAGCATGG - Exonic
915431562 1:155870969-155870991 AGGACATCTGGCCCCAAGAAGGG + Intronic
915828795 1:159105897-159105919 ACCAAGGATGGCCCGAAGCATGG - Intronic
916390098 1:164321639-164321661 AGTACCGAAGGCCCCAGGCACGG - Intergenic
916551625 1:165855331-165855353 AGCAAAGATGTCCCCAAATAAGG + Intronic
917361272 1:174178784-174178806 AGAACACATGGACCCAGGCAGGG + Intronic
918535528 1:185570121-185570143 AGGAAAGATGGTCCCTAGCAAGG - Intergenic
920337408 1:205254411-205254433 GGAACAGATAGCCCAAAGCATGG - Intronic
920544219 1:206802055-206802077 AGCACAGGGGGCTCCCAGCATGG + Intronic
921800029 1:219392100-219392122 AAGACAGATGACCCCAAACAGGG - Intergenic
924403239 1:243712440-243712462 AGCAGAAATTGCCCAAAGCATGG - Intronic
924891545 1:248287147-248287169 AGTACAGAAGGACACAAGCATGG + Intergenic
1062761161 10:21299-21321 ATCATAGATGGAGCCAAGCATGG + Intergenic
1063591612 10:7400736-7400758 AGCAGAGGAGGCCCCAAGCCAGG - Intronic
1064274317 10:13892165-13892187 AGCACGGAGGTCCCCAAGCGGGG + Intronic
1065073679 10:22054198-22054220 GGACCAGATGGCCCAAAGCATGG - Intergenic
1066272616 10:33838017-33838039 AGTACAGATACCTCCAAGCAGGG + Intergenic
1072656504 10:97334072-97334094 AGCGCCGATGGACCCAAGCCGGG - Exonic
1073113268 10:101075509-101075531 GGCACAGATGGCCCTAACCAAGG - Intergenic
1073217132 10:101842671-101842693 AGCCCAGGTGGACCCAAGGAGGG - Intronic
1073931775 10:108584840-108584862 AGCAAAGCTGGGGCCAAGCAAGG + Intergenic
1074418172 10:113285447-113285469 AGCAGGGATGTTCCCAAGCAGGG - Intergenic
1075341440 10:121649542-121649564 TGCACAGATGCCACCAGGCAGGG - Intergenic
1075967613 10:126626217-126626239 ATCACAGAAGGCCCCAGGGAAGG + Intronic
1076036754 10:127204983-127205005 AGCTCAGATAGCCCAAGGCATGG - Intronic
1076151653 10:128167246-128167268 AGAACACATGGACACAAGCAGGG - Intergenic
1077193905 11:1269789-1269811 AGCACAGCTGGCCCCTTACAGGG - Intergenic
1077266720 11:1654576-1654598 AGTACAGATTGCCCCTAGAAGGG - Intergenic
1077282748 11:1753041-1753063 AGCCCAGCTGGGCCCAAGCTGGG + Exonic
1079184754 11:18226939-18226961 AGCACACATGGACATAAGCATGG + Intronic
1079355025 11:19723583-19723605 GGCACAGAAGGCCCCAACGAGGG - Intronic
1079983154 11:27173363-27173385 AGCACATATGGACCCAAGTATGG + Intergenic
1080155694 11:29108103-29108125 TGCACAGATGACCCTAGGCATGG + Intergenic
1081714359 11:45238003-45238025 AGCACAGATGGCCCCTGGCAGGG - Intergenic
1082963287 11:58939574-58939596 ACCACAGCTGGCCCCAACCATGG + Intronic
1083349281 11:62015726-62015748 ATCACAGATGGCAACAACCAAGG - Intergenic
1084403895 11:68960142-68960164 AGCACAGATGGCCCTGGACAGGG - Intergenic
1085701691 11:78751713-78751735 AGCACAGATGCACCCAACAACGG + Intronic
1085732428 11:79011169-79011191 AGAACAGATGGGCCCACGCATGG + Intronic
1087918540 11:103838389-103838411 AGCACACATGGACACAAACAGGG + Intergenic
1089512762 11:119010896-119010918 TCCACAGATGGACCCAGGCAGGG + Intronic
1089894659 11:121918075-121918097 AGCCCAGATGGCCACAACCTGGG - Intergenic
1090876038 11:130789740-130789762 AGCCCAGGTGACCCCATGCAGGG - Intergenic
1091002035 11:131917820-131917842 GGCACAGATGGGACCAAGGAGGG + Intronic
1091306492 11:134539505-134539527 TTCCCAGGTGGCCCCAAGCATGG + Intergenic
1091629247 12:2146866-2146888 AGCAGGGCTGGACCCAAGCAGGG + Intronic
1091920813 12:4303212-4303234 ATCACACAAGGCCCCAAGGATGG - Exonic
1094733813 12:33209400-33209422 AACAGAGATGGACCCAAGAAAGG - Intergenic
1094811898 12:34146712-34146734 AGAACACATGGACACAAGCAGGG + Intergenic
1095519532 12:43046243-43046265 AGCACAGATGGACCCTAAGAAGG + Intergenic
1096902371 12:54898586-54898608 AGAACACATGGACCCAAGGAGGG + Intergenic
1097349151 12:58528628-58528650 CACACAGATGGCCCCACGGAGGG - Intergenic
1098224042 12:68302449-68302471 AGCACAATTGGTCCCAAGGAGGG + Intronic
1098708019 12:73715964-73715986 AACAAAGATGTCCCCAAACAAGG - Intergenic
1099433008 12:82610466-82610488 AACACTGATGGCACAAAGCATGG - Intergenic
1100744058 12:97626081-97626103 AACACACTTGGCTCCAAGCATGG - Intergenic
1102363036 12:112305018-112305040 AGAACAAATTGCCCCAAGCCAGG - Intronic
1104382202 12:128316835-128316857 GTCACAGATGGCCCCAGGAAAGG - Intronic
1105642320 13:22278538-22278560 GGCACAGATGGCCCAAAAGATGG - Intergenic
1106454133 13:29911918-29911940 AGCCCAGAGGGATCCAAGCATGG - Intergenic
1109273954 13:60283688-60283710 AGCACACATGCCCCCAACCCAGG - Intergenic
1110937154 13:81305332-81305354 CGCACATAGGGTCCCAAGCACGG - Intergenic
1112195728 13:97224323-97224345 AGCACAGATGGCCCCAAGCAGGG + Intronic
1112505436 13:99971909-99971931 AGCGCAGGCGGCCGCAAGCACGG - Exonic
1112685751 13:101824350-101824372 AGCACAGAGAACCCCAAGAATGG - Intronic
1114030442 14:18573971-18573993 ATCATAGATGGAGCCAAGCATGG - Intergenic
1115474186 14:33798560-33798582 AGCACAGGTGCCCTCAAGAAGGG - Intronic
1117050465 14:51854877-51854899 AGCACAGAGGGACACAGGCAGGG - Intronic
1117324607 14:54657689-54657711 AGCACAGCTGACCCCTAGAAAGG - Intronic
1120055617 14:79920425-79920447 AGTCCAGATGGCCTCAACCAGGG - Intergenic
1122340684 14:101026458-101026480 GGCACAGATGCCCCAAAGCAAGG - Intergenic
1126421321 15:48476201-48476223 AGCACAAATACTCCCAAGCAGGG + Intronic
1127164257 15:56228197-56228219 AGCTCAGAGGACACCAAGCATGG - Intronic
1129607446 15:77031741-77031763 AGCAGAGAGGGCCCCCAGCCAGG + Intronic
1130048515 15:80464453-80464475 AGCCCAGATCCTCCCAAGCAGGG - Intronic
1131786816 15:95922340-95922362 AGCACACAAGGGCTCAAGCAGGG + Intergenic
1132227248 15:100151778-100151800 TACACAGATGGCCACAGGCATGG + Intronic
1132929679 16:2452444-2452466 AGCACAGATCGTCCCAACCCTGG + Intronic
1134037718 16:11044084-11044106 AGCACAGATGGACAGCAGCATGG + Intronic
1136283712 16:29229472-29229494 AGCCCAGAAGACCCCAAGCCAGG - Intergenic
1136545131 16:30950216-30950238 CACACAGCTGGCCACAAGCAGGG - Intronic
1137838792 16:51620750-51620772 AGAACAAGTGGCCCCAAGCTGGG - Intergenic
1138546449 16:57722494-57722516 AGCACAGATCCACCCAAGAATGG - Intronic
1139636179 16:68259957-68259979 GGGACACATGGCCCCAGGCAGGG - Exonic
1140043622 16:71425518-71425540 CGCACTGCTGGCTCCAAGCAGGG - Intergenic
1141648215 16:85378580-85378602 AGCACGAAGGGCGCCAAGCAGGG - Intergenic
1141881831 16:86865348-86865370 GGCACAGAGGGCTCCAAGCTTGG + Intergenic
1142058578 16:88015595-88015617 AGAACGGGTGACCCCAAGCAGGG - Intronic
1142424482 16:89993920-89993942 AGCACACATGGCTCCCACCACGG - Intergenic
1142625621 17:1190069-1190091 AGAACAAATGGCCCCTAGGATGG + Intronic
1143747581 17:9005024-9005046 ATCACATGTGGCCCCAAGTAAGG + Intergenic
1144132685 17:12263370-12263392 AGAACAGATGGACACAAGAAGGG + Intergenic
1145088408 17:19964461-19964483 AGAACAGATAGCCTCAAGAAGGG - Intronic
1147319870 17:39639696-39639718 AGCATAGTTGCCCCCAGGCATGG - Intronic
1148127250 17:45243204-45243226 AGCCCAGAAGGCCCCCAGCAAGG + Exonic
1148856902 17:50583903-50583925 GGCAAAGAGGGCCCCAAGTAAGG + Intronic
1149398478 17:56269814-56269836 AGAACAGAGGGCCCCAAACACGG - Intronic
1149416818 17:56468596-56468618 ACCACAGATGGCTCCCAGGACGG - Intronic
1149777644 17:59370759-59370781 GGCACAGGTGGCCCTCAGCAGGG + Intronic
1150416425 17:64992496-64992518 AGCAAATATGTCCCCATGCAAGG + Intergenic
1150622715 17:66820516-66820538 AACACAGATGGACCCAACCAGGG + Intergenic
1151547742 17:74803508-74803530 AGCGCAGAAGGTCCCCAGCAGGG - Intronic
1152226708 17:79096187-79096209 AGCACATGTGGCCCCATGAAGGG + Intronic
1152439057 17:80294220-80294242 GGCACAGATGGCCCTTGGCATGG - Intronic
1152600754 17:81260983-81261005 ATCACAGCTGGCACCATGCATGG + Intronic
1152926103 17:83088484-83088506 AGCACAGATGTGGCCAAGCCAGG - Intronic
1152954068 18:21634-21656 ATCATAGATGGAGCCAAGCATGG + Intergenic
1155997004 18:32340912-32340934 AGCACAGAGAAACCCAAGCAAGG - Intronic
1156174205 18:34522838-34522860 AGAGCAGATGGGCCCAAGCAGGG + Intronic
1156337118 18:36182026-36182048 AGCACAGAAGGGACCAAGAAGGG + Intergenic
1156452132 18:37272953-37272975 AGAACAGCTGGCCCCAGGCTGGG - Intronic
1157576303 18:48746146-48746168 AGCAAAGATGGCCCCACAGATGG - Intronic
1157742036 18:50102201-50102223 AGAACAGATGGACACAAGGAGGG + Intronic
1158023460 18:52869851-52869873 AGAACAGACAGCCCCAAGCCTGG + Intronic
1158346909 18:56525052-56525074 AGAACAGATGGGCCCGAACAGGG - Intergenic
1160368440 18:78349827-78349849 AGCACAGCTGGCCTCAGGGAGGG + Intergenic
1160375683 18:78410050-78410072 AGCACAGATGTCACCAAGGCAGG + Intergenic
1160802515 19:976903-976925 ACCACAGATGTCCCCAGACATGG - Intergenic
1161028424 19:2047212-2047234 ACCACAGATGTCCCCAGACATGG - Intronic
1161155184 19:2728856-2728878 ACCACAGATGTCCCCAGACATGG + Intronic
1161323154 19:3650456-3650478 ACCACAGATGTCCCCAGACATGG - Intronic
1161480310 19:4507062-4507084 ACCACAGATGTCCCCAGACATGG + Intronic
1162450471 19:10751276-10751298 AGCACAGAGGTGGCCAAGCAGGG + Intronic
1165322386 19:35094085-35094107 AGCCCAGGTGGACCCAAACAGGG - Intergenic
1167085886 19:47309598-47309620 AGAAGAGATGGCCCCAAATAGGG + Intronic
1167300471 19:48674673-48674695 AGCACATAGTGCCCCAAGCTGGG + Intergenic
1202647410 1_KI270706v1_random:155368-155390 ATCATAGATGGAGCCAAGCACGG + Intergenic
925878779 2:8333311-8333333 GGCACACAGGGCCCCAGGCAAGG + Intergenic
926076750 2:9949168-9949190 AGCACAGATGGTCCCAAATAGGG - Intergenic
931096702 2:58948482-58948504 AGCAGAGATGCACCCAGGCATGG - Intergenic
931599076 2:63984371-63984393 AACATAGATGGACCTAAGCAGGG - Intronic
932837979 2:75055312-75055334 ATCACAGATTGCACCAAGCAGGG + Intronic
932995913 2:76852317-76852339 AGCAGAGATGGCTTCAAGGATGG - Intronic
934162349 2:89262164-89262186 AGCACACATGGACACAAGGAGGG + Intergenic
934204926 2:89920189-89920211 AGCACACATGGACACAAGGAGGG - Intergenic
934310200 2:91856172-91856194 ATCACAGATGGAGCCAAGCACGG + Intergenic
934503035 2:94873898-94873920 AGCACAGAGGGTCCCCAGCAGGG + Intronic
935057125 2:99577325-99577347 AGCACAGAAAGCACCATGCAGGG - Intronic
935145319 2:100391395-100391417 AGCAAGGATGCCGCCAAGCACGG - Intergenic
935343714 2:102083531-102083553 AGAACAGAGGGACCCAAGGATGG - Intronic
936496305 2:113024915-113024937 AGCACAAATGGCCTCAAGGATGG - Intronic
937236736 2:120435812-120435834 AGCACAAATGACCCCAGGGAGGG + Intergenic
938497773 2:131811797-131811819 ATCATAGATGGAGCCAAGCATGG + Intergenic
938717780 2:134036593-134036615 AGCAGAGATGGCCTTAAGTATGG - Intergenic
940722905 2:157301112-157301134 AGCAAAGATGGGACAAAGCATGG + Intronic
945549397 2:211200821-211200843 AGAACACATGGACCCAAGGACGG - Intergenic
947101718 2:226628308-226628330 ACCAAAGATGGCCCCAAGGATGG - Intergenic
948252219 2:236538525-236538547 GGCAAAACTGGCCCCAAGCATGG + Intergenic
1170737724 20:19025952-19025974 AGTACAGCTGGCCTCAAGCCAGG + Intergenic
1172572637 20:35982464-35982486 TGCAGAGGTGGCCCAAAGCACGG - Intronic
1173655919 20:44700296-44700318 CACGCAGATGGCTCCAAGCAGGG + Intergenic
1175028801 20:55931593-55931615 AGCACAGATGGACATAAACACGG + Intergenic
1176377644 21:6094378-6094400 ATGACAGATGGGTCCAAGCAGGG - Intergenic
1176604454 21:8817405-8817427 ATCATAGATGGAGCCAAGCACGG - Intergenic
1177664815 21:24141128-24141150 AGCACACATGGACACAAACATGG + Intergenic
1179474463 21:41634347-41634369 AGGACTCATGGCCCCAGGCAGGG + Intergenic
1179547364 21:42121876-42121898 AGCTAAGATGGCACCCAGCAGGG + Intronic
1179745830 21:43443866-43443888 ATGACAGATGGGTCCAAGCAGGG + Intergenic
1179807270 21:43847644-43847666 AGGCCAGATGGCCCCAGGCAGGG + Intergenic
1180346745 22:11709013-11709035 ATCATAGATGGAGCCAAGCACGG - Intergenic
1180354501 22:11827132-11827154 ATCATAGATGGAGCCAAGCACGG - Intergenic
1180454555 22:15501027-15501049 ATCATAGATGGAGCCAAGCATGG - Intergenic
1180536941 22:16402105-16402127 ATCACAGATGGAGCCAAGCACGG + Intergenic
1182537944 22:31019915-31019937 ACCACAGACAGCCCCAACCAGGG - Intergenic
1182984623 22:34704829-34704851 AGGACAGATTGCCTCCAGCAGGG - Intergenic
1183346966 22:37313292-37313314 AGGCCAGATGGCCCCAACAAAGG - Intronic
1183441548 22:37825654-37825676 AGCACAGCCCGCCCCCAGCAGGG + Intergenic
1185392816 22:50571796-50571818 AACACAGATGGCCCCAGGGGCGG + Intronic
953039872 3:39246386-39246408 AGCACAGATGGACACAAAAAGGG - Intergenic
953179317 3:40581779-40581801 AGAACAGCTGGGCCCAAGCAAGG - Intergenic
954044307 3:47916398-47916420 AGCAGAGGTGGCCCCAGTCAAGG - Exonic
954439121 3:50511907-50511929 GCCATGGATGGCCCCAAGCAAGG - Intergenic
954789073 3:53117470-53117492 ATCCCTGATGGCACCAAGCATGG + Intronic
956495306 3:69819465-69819487 AGAACAGATGGCCCGAAGTGTGG + Intronic
956658037 3:71570903-71570925 AGCACAGCTGGCCCCAGCCTGGG + Intronic
956845139 3:73175601-73175623 AACTCAAATGGCTCCAAGCAGGG - Intergenic
958822632 3:98993089-98993111 AGCACAGATGGACACAAAGAAGG - Intergenic
960061202 3:113323417-113323439 AGCACACATGGACATAAGCACGG + Intronic
960999636 3:123365491-123365513 AGCAGAGTGGCCCCCAAGCAAGG + Intronic
961432672 3:126894175-126894197 AAAACACATGGCCTCAAGCAAGG - Intronic
961669156 3:128516204-128516226 AGCCCATATGGCCCCCAGCTGGG + Intergenic
962398765 3:135039685-135039707 AGCCCTGCTGGCCCCGAGCAAGG - Intronic
963035334 3:141020711-141020733 AGTACAGCTGGCCACAAGGAAGG + Intergenic
965206731 3:165729040-165729062 AGACCAGTAGGCCCCAAGCAAGG - Intergenic
965241207 3:166200862-166200884 AGAACACATGGACCCAAGGAGGG + Intergenic
967918338 3:194596166-194596188 CGCCCAGAAGGCCTCAAGCAGGG + Intronic
967994990 3:195159780-195159802 ACCACAGAGGGCCACATGCACGG + Intronic
968657176 4:1783662-1783684 TGCACAGATTGCCCCAAGGCAGG + Intergenic
968657784 4:1786068-1786090 GGCAGAGGTGGCCCCAAGCTTGG + Intergenic
968958010 4:3728799-3728821 TGCACAGACGGCCCCTTGCAGGG - Intergenic
969047348 4:4346019-4346041 AGAACAAATGACCCCAAGCTGGG + Intergenic
969118740 4:4891149-4891171 TTCACAAATGGCCCCAAGGATGG - Intergenic
969227757 4:5810310-5810332 AGGACAGATGAACCCAGGCATGG - Intronic
969270799 4:6099284-6099306 AGCAAAGAAGGACCAAAGCAGGG - Intronic
970157856 4:13159556-13159578 AACACGGAAGGCCCAAAGCATGG + Intergenic
973338833 4:48984335-48984357 AGAACACATGGCCACAAGGAGGG + Intergenic
973373671 4:49273535-49273557 ATCATAGATGGAGCCAAGCACGG + Intergenic
973383741 4:49336685-49336707 ATCATAGATGGAGCCAAGCACGG - Intergenic
973387346 4:49521677-49521699 ATCATAGATGGAGCCAAGCACGG - Intergenic
973972515 4:56227654-56227676 TGCACAGATAGCCACAGGCAGGG + Intronic
976095736 4:81506585-81506607 AGCAGAGATGGCTCCAAGATTGG + Intronic
976311929 4:83621371-83621393 AGCACTGGTGGCCCAGAGCAGGG - Intergenic
980033462 4:127856948-127856970 AGCAATGATGGCCCTAGGCAGGG - Intergenic
980168339 4:129255143-129255165 AGAACACATGGACACAAGCAGGG - Intergenic
983692016 4:170482063-170482085 AGCACAGCTGGGGCAAAGCAAGG + Intergenic
983965456 4:173804134-173804156 AGAACACATGGACCCAGGCAGGG - Intergenic
985773342 5:1826638-1826660 AGCAAACCTGGCCCCAAGGACGG + Intergenic
985918400 5:2946131-2946153 AGCACTGATGGCCCCCAGTCAGG - Intergenic
985929227 5:3043225-3043247 AGCACTGAATGCCCCAGGCAGGG - Intergenic
986075071 5:4327742-4327764 AGCACAGTTGGCTCCATGCTGGG + Intergenic
986144352 5:5063728-5063750 AGCTCAGAAAGCCCCCAGCAGGG - Intergenic
986495495 5:8337920-8337942 AGCACAGTGGGTGCCAAGCATGG - Intergenic
990053611 5:51541305-51541327 AGCTCAGAGGACACCAAGCAAGG - Intergenic
990974821 5:61550154-61550176 AGCACAGATATGGCCAAGCAGGG + Intergenic
992997637 5:82348406-82348428 TGCTCAGATGGCCCCAAGCAGGG + Intronic
995020336 5:107360150-107360172 AGCACAGGTTGCCCCTACCAAGG + Intergenic
996201957 5:120686372-120686394 AAGACAGATGTCCCCAGGCAGGG + Exonic
997438322 5:133891104-133891126 TGCCCAGAGGGCCCCAAACATGG + Intergenic
997690159 5:135822931-135822953 AGCAAAGATGGCCCTGAGCTGGG + Intergenic
997724269 5:136107032-136107054 ATCACAGGTGGCCCCCAGCCAGG - Intergenic
999936016 5:156486519-156486541 AGTACAGATGGGCACTAGCAGGG - Intronic
1001648123 5:173297246-173297268 AGCAGAGATGGGCCAGAGCAAGG - Intergenic
1001656706 5:173356273-173356295 AGCACAGACCGGCCCAGGCAGGG - Intergenic
1003226503 6:4210863-4210885 AGCCAAGGTGGCCCCAAGCAAGG - Intergenic
1003922241 6:10843715-10843737 AGCACAGATAATACCAAGCAGGG - Intronic
1004075678 6:12342187-12342209 AGTGCAGATGGCCCCAAGTCTGG + Intergenic
1005887459 6:30107715-30107737 ACCAGAGATGGCCTCAGGCAGGG - Intronic
1007150266 6:39683662-39683684 AACACTGATGGCCCCAACCTTGG - Intronic
1010596676 6:77771737-77771759 AGCACACATGGACACAAGGAGGG + Intronic
1016710359 6:147164452-147164474 AACACATATGGCCGCAAGAATGG + Intergenic
1017617412 6:156260022-156260044 ACCACACATGGTACCAAGCATGG + Intergenic
1018634457 6:165848651-165848673 AGCCCATATGGCCCCAAGGTTGG + Intronic
1019121531 6:169808576-169808598 AGCACTGATGCCCCCAGGTATGG + Intergenic
1019235517 6:170609146-170609168 AGCAGAGATGACTCCAAGCTGGG - Intergenic
1019307952 7:344745-344767 AGCTCAGCTGGCCCCAGGCAGGG + Intergenic
1021428331 7:20529497-20529519 AGCCCAGCAGTCCCCAAGCAAGG + Intergenic
1026586559 7:71660547-71660569 AGTACAGCTGGTCCCAAGAAAGG - Intronic
1028641656 7:93048792-93048814 AGCTCAGAAAACCCCAAGCAAGG + Intergenic
1029161792 7:98557670-98557692 GGCACAGATGGCTGGAAGCAAGG - Intergenic
1029853284 7:103487209-103487231 AGAACAGATGGACACAGGCAGGG + Intronic
1030365880 7:108645621-108645643 GGCACAGCTGGCCCAAAGCATGG + Intergenic
1030872983 7:114780657-114780679 AGCAAGGATGGCTCCAAACAGGG - Intergenic
1031640266 7:124154347-124154369 AGCACAAGTGGAGCCAAGCAGGG - Intergenic
1033792102 7:144802963-144802985 AGAACACATGGACACAAGCAGGG + Intronic
1034566283 7:151918229-151918251 GGCACAGCTGGCCCCAGGCATGG + Intergenic
1034956325 7:155337622-155337644 AGCATAGAGGGCCCCCAGGAAGG + Intergenic
1035515350 8:228123-228145 AGCAGAGATGACTCCAAGCTGGG - Intergenic
1035539713 8:423484-423506 AGCACACATGGACACAAACATGG - Intronic
1039677393 8:39684633-39684655 AGCACAGACAGCCCCCACCAGGG - Intronic
1042751672 8:72164125-72164147 AGCACATATGGACACAAACAGGG - Intergenic
1048801161 8:138194888-138194910 TGCACAGATGGCCTCAGACATGG - Intronic
1048842524 8:138578202-138578224 AGACCAGATGGCCACAGGCATGG + Intergenic
1049002039 8:139832445-139832467 AGCAGGTATGGCCCGAAGCAGGG + Intronic
1049404761 8:142447439-142447461 AGCAGAGAAGGCCCCATGCTGGG + Intergenic
1049675550 8:143887368-143887390 GGCACAGATGAACCCGAGCAGGG + Intergenic
1050453058 9:5804309-5804331 AGCAGAGTAAGCCCCAAGCAAGG - Intronic
1050914018 9:11108463-11108485 AGCACATATGGACCCACCCAGGG + Intergenic
1052558219 9:30048528-30048550 AGCCCAGCAGGCCCTAAGCAAGG - Intergenic
1052726840 9:32238820-32238842 AGCACACATGGACCAAAACATGG - Intergenic
1053537253 9:38937985-38938007 AGCACACATGAGCCAAAGCAAGG - Intergenic
1054351310 9:64018809-64018831 ATCATAGATGGAGCCAAGCACGG - Intergenic
1054628882 9:67425945-67425967 AGCACACATGAGCCAAAGCAAGG + Intergenic
1056989386 9:91396318-91396340 AGAACAGATTGCTCCACGCAAGG + Intergenic
1056994447 9:91443318-91443340 ATCCCAGATGGCCTGAAGCATGG - Intergenic
1057309311 9:93931860-93931882 TCCACAGATGGCCTCATGCAAGG - Intergenic
1057579911 9:96278567-96278589 AGCCCAGCTGGACACAAGCAGGG - Intronic
1058510795 9:105713910-105713932 AGCAGAGGTGGCCCCAAAGAGGG - Intronic
1060100528 9:120836685-120836707 AGTACAGATGGGGCCAGGCATGG - Intronic
1060915688 9:127388610-127388632 AGCACAGAATTCCCCAAGCAGGG + Intronic
1061588916 9:131585552-131585574 TGCACACAAGGCCCCAAGCCTGG - Intronic
1203697366 Un_GL000214v1:111540-111562 ATCATAGATGGAGCCAAGCACGG + Intergenic
1203551839 Un_KI270743v1:169488-169510 ATCATAGATGGAGCCAAGCACGG - Intergenic
1185615104 X:1416520-1416542 TGCACAGATGGGCACACGCACGG + Intronic
1185677755 X:1862347-1862369 ATCACACCTGACCCCAAGCAGGG + Intergenic
1186929679 X:14375027-14375049 AGAACACATGGACCCAAGGAGGG + Intergenic
1189378561 X:40484906-40484928 AACGCAGATGGGCCCCAGCAGGG - Intergenic
1189579318 X:42389121-42389143 AGCACTGCTGGCCTCCAGCATGG + Intergenic
1191586631 X:62834134-62834156 GGCTCAAATGGCCCCAGGCATGG - Intergenic
1194638645 X:96375794-96375816 TGCAAATATGGCCCAAAGCAGGG - Intergenic
1201757043 Y:17497735-17497757 AGAACACATGGACACAAGCAGGG + Intergenic
1201844511 Y:18408249-18408271 AGAACACATGGACACAAGCAGGG - Intergenic