ID: 1112196886

View in Genome Browser
Species Human (GRCh38)
Location 13:97235036-97235058
Sequence TGCTCTGCGTGTCCCTAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 96}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112196886_1112196890 -5 Left 1112196886 13:97235036-97235058 CCTTCTTAGGGACACGCAGAGCA 0: 1
1: 0
2: 0
3: 8
4: 96
Right 1112196890 13:97235054-97235076 GAGCAAACAAAGGAAGGGTGAGG 0: 1
1: 0
2: 2
3: 37
4: 494
1112196886_1112196889 -10 Left 1112196886 13:97235036-97235058 CCTTCTTAGGGACACGCAGAGCA 0: 1
1: 0
2: 0
3: 8
4: 96
Right 1112196889 13:97235049-97235071 ACGCAGAGCAAACAAAGGAAGGG 0: 1
1: 0
2: 3
3: 25
4: 306
1112196886_1112196891 -2 Left 1112196886 13:97235036-97235058 CCTTCTTAGGGACACGCAGAGCA 0: 1
1: 0
2: 0
3: 8
4: 96
Right 1112196891 13:97235057-97235079 CAAACAAAGGAAGGGTGAGGAGG 0: 1
1: 0
2: 7
3: 56
4: 714
1112196886_1112196894 23 Left 1112196886 13:97235036-97235058 CCTTCTTAGGGACACGCAGAGCA 0: 1
1: 0
2: 0
3: 8
4: 96
Right 1112196894 13:97235082-97235104 TGTTGAACCATTTCTCTATGAGG 0: 1
1: 0
2: 0
3: 16
4: 182
1112196886_1112196892 -1 Left 1112196886 13:97235036-97235058 CCTTCTTAGGGACACGCAGAGCA 0: 1
1: 0
2: 0
3: 8
4: 96
Right 1112196892 13:97235058-97235080 AAACAAAGGAAGGGTGAGGAGGG 0: 1
1: 0
2: 6
3: 119
4: 1307
1112196886_1112196893 0 Left 1112196886 13:97235036-97235058 CCTTCTTAGGGACACGCAGAGCA 0: 1
1: 0
2: 0
3: 8
4: 96
Right 1112196893 13:97235059-97235081 AACAAAGGAAGGGTGAGGAGGGG 0: 1
1: 0
2: 9
3: 119
4: 1165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112196886 Original CRISPR TGCTCTGCGTGTCCCTAAGA AGG (reversed) Intronic
901481187 1:9526429-9526451 TGATCTGCCTGCCTCTAAGAGGG - Intergenic
902722613 1:18314145-18314167 AGCTCACCGTGTCCCTAATAAGG + Intronic
904451901 1:30618719-30618741 TGCTCTGCCTCTCTCTGAGATGG + Intergenic
908823889 1:68115239-68115261 TCTTCTTCGTGTCCCTGAGAGGG - Intronic
911169242 1:94753897-94753919 TGCTCTGCTTCTCCCTGAGTTGG - Intergenic
913495212 1:119422212-119422234 GGCTCTGCGGGACCCCAAGAAGG + Exonic
915896240 1:159813445-159813467 TTCACTGGGTGTCCCTTAGAGGG - Intronic
917487045 1:175464964-175464986 TGCCCTGCCTGTTCCTAAGTGGG + Intronic
923043226 1:230334520-230334542 TGGTCTGTGTGGCCCTAGGAGGG + Intronic
923450165 1:234109769-234109791 TGCTCTGGGTGTTCCAGAGAGGG + Intronic
1063362693 10:5470532-5470554 TCCTCTGCCTGTGCCTAAGGTGG + Intergenic
1066204089 10:33170598-33170620 AGCTGTACGTGTCCCTCAGAGGG + Intergenic
1070325354 10:75385126-75385148 TGGCCTCCGGGTCCCTAAGATGG - Intergenic
1074972587 10:118551463-118551485 AGCTTTGAGTGTCCCTGAGACGG + Intergenic
1077250956 11:1560471-1560493 AGCTCCCCGTGTCCCTAAAAAGG + Intronic
1079502317 11:21115388-21115410 TGTTGTGTGTGTGCCTAAGAGGG + Intronic
1083010078 11:59388583-59388605 TGCTCTGAGGTTCCCTAACAGGG + Intergenic
1083939850 11:65889979-65890001 TGGTCTGAGGGTCCTTAAGAGGG - Intergenic
1086930458 11:92687518-92687540 AACTTTGAGTGTCCCTAAGAAGG - Intronic
1088647389 11:111927637-111927659 CTCTCTGCTGGTCCCTAAGAGGG + Intronic
1091000125 11:131903912-131903934 TGATCTGTGTGTCACTGAGAAGG - Intronic
1092005879 12:5070144-5070166 TGCTCTGCGTGTCTCTGGGGAGG + Intergenic
1102223478 12:111210880-111210902 TGCTCTGCGTCTCCATCAGCTGG - Intronic
1103010139 12:117451934-117451956 TGCTGTGTGTGGCCCCAAGAGGG + Intronic
1104079230 12:125415654-125415676 TGCTCTGCGTGTCCGGGCGATGG - Exonic
1112196886 13:97235036-97235058 TGCTCTGCGTGTCCCTAAGAAGG - Intronic
1114021946 14:18487920-18487942 TACTCTGCTTGTCCCTCACAAGG + Intergenic
1116907742 14:50421640-50421662 TGCTCTGCTTGTCTCTTACATGG - Intronic
1119739310 14:77003901-77003923 TTATCTGCGAGTCCCTAAGATGG + Intergenic
1120696002 14:87646256-87646278 TGTTCTGTCTTTCCCTAAGAAGG + Intergenic
1121312797 14:92944240-92944262 TGCTCTGCTTGGCCCCAAAAGGG + Intronic
1122343785 14:101045624-101045646 AGCTCTGCGTGTGCCCAGGAAGG + Intergenic
1126341392 15:47644984-47645006 TGATCTGTGTGTCTCTAAAAGGG + Intronic
1127541446 15:59942792-59942814 TGCTCTGCATGATCCTCAGAAGG - Intergenic
1132772030 16:1568896-1568918 AGCTCAGTGTGTCCCTATGACGG - Intronic
1139630888 16:68231295-68231317 TGCTCAGCGTTGCCATAAGAAGG - Exonic
1140894736 16:79314852-79314874 TGCTCTGAGTTTCCCTGAGGAGG - Intergenic
1142223933 16:88868292-88868314 TGCTCTGCTTTTTCCAAAGAGGG + Intergenic
1146283560 17:31559893-31559915 AGCTCTGGGTGTCCCTCAGGCGG - Intergenic
1147144428 17:38477086-38477108 GGTTCTGGGTGTCCCTGAGAAGG + Intronic
1159338915 18:67109302-67109324 TGCTCTGAGTGTGCTTCAGAGGG + Intergenic
1160032435 18:75274074-75274096 TGCTGTGCGTGTCCCCCCGATGG + Intronic
1160182515 18:76647794-76647816 TGCCCTGCACCTCCCTAAGAAGG - Intergenic
1165349013 19:35266704-35266726 TGCTGTCCGTGTCCCGAAGCAGG - Exonic
1165396120 19:35564524-35564546 TGCTCTGTGTGTCACTCAAATGG + Intergenic
926174028 2:10573155-10573177 TTCCCTGGGTGTCCATAAGACGG - Intronic
926788644 2:16546798-16546820 TCCTCAGTGTGTCCCTTAGAAGG - Intergenic
927963943 2:27257757-27257779 TGCCCTGCGTGTGCCTGAGAAGG - Intronic
930524148 2:52505510-52505532 TTCTCTGATTGTCCCTGAGATGG + Intergenic
930838912 2:55824980-55825002 TGCTCTGCGCTTCCCTGGGACGG + Intergenic
935169397 2:100599246-100599268 TGCTCTGCCTGTAACTTAGAGGG - Intergenic
938783056 2:134602789-134602811 TCTTCTGCCTGTCCCTGAGAGGG + Intronic
940737587 2:157471062-157471084 TTCTCTCCCTGTCCCGAAGAAGG + Intronic
943351853 2:186805805-186805827 GGCTCTGTGTTTCCCTAGGATGG - Intergenic
943351909 2:186806082-186806104 AGCTCTGCATTTCCCTAGGAAGG - Intergenic
948037858 2:234873659-234873681 TGCGCTGTGTGGCTCTAAGAAGG + Intergenic
948726358 2:239936411-239936433 TGCTCTGCGTGACACTGAAACGG + Intronic
1169640243 20:7743108-7743130 TGCTCTGCTGGCCCCTAAGCTGG - Intergenic
1171082667 20:22203627-22203649 TGCTCAATGTGTCCCTTAGACGG + Intergenic
1171333060 20:24358219-24358241 TGCCCAGCATGCCCCTAAGAGGG + Intergenic
1171449531 20:25225939-25225961 TGCTGTGCATGTCCCTGCGATGG + Exonic
1172115984 20:32573962-32573984 TGCTCTGAGAGACCCCAAGATGG + Intronic
1176258717 20:64167601-64167623 TGCTCTGCCTGTCCCAATGCTGG + Intronic
1179078342 21:38144942-38144964 TGCTCTACATGTCCCTGAGAAGG + Intronic
1180215093 21:46318590-46318612 TGCTCTGAGGGTCCCTAGGAGGG - Intronic
1181032354 22:20154671-20154693 TGCTCTCTGTGTCCCTGAGTGGG + Intergenic
1181511055 22:23388883-23388905 TGCTCTCTGTGTCCCTGAGTGGG - Intergenic
1183579117 22:38712797-38712819 TGCTGGGAGTGTTCCTAAGAAGG - Intronic
1183978713 22:41527555-41527577 TGCACTGTGTGAGCCTAAGAAGG - Exonic
950475236 3:13210679-13210701 CGCTCTGAGTTTTCCTAAGAAGG + Intergenic
952879650 3:37975550-37975572 TCCTCTCCGTGTACATAAGATGG - Intronic
953747123 3:45583579-45583601 TGCTGTGTGTGTCCCAAAGCTGG - Intronic
958482017 3:94654598-94654620 TGCTCTGTGTGGCTCTCAGATGG + Intergenic
959328609 3:104972782-104972804 TGCTTTTCCTGTCCTTAAGAAGG + Intergenic
963828714 3:149984043-149984065 TTCTCTGCGTGTCTCTTATAAGG + Intronic
971456180 4:26846930-26846952 TTCTCTGCCTGCTCCTAAGATGG + Intergenic
974688799 4:65268539-65268561 TGCTTTGGGTTTCCTTAAGAAGG - Intergenic
986507059 5:8462913-8462935 TGGCCTGCCTGTCTCTAAGATGG - Intergenic
990823361 5:59869192-59869214 AGCTCTGAGAGTCCCTAACAGGG + Intronic
993060640 5:83034996-83035018 TGCTCTGAGTGGCTCTTAGAAGG + Intergenic
999289747 5:150416431-150416453 TGCTCAGCTGGCCCCTAAGAAGG - Intergenic
999868471 5:155727594-155727616 TGCTCTGCGTGCCCTTAGGCAGG - Intergenic
1002171581 5:177377745-177377767 TACCCTGCGTGTCCTCAAGAAGG - Intergenic
1002394579 5:178942751-178942773 CACTTTGCCTGTCCCTAAGAGGG + Exonic
1010495962 6:76533635-76533657 AGCTCTGCATTTCCCCAAGATGG - Intergenic
1011731948 6:90273833-90273855 TCCTCTGGGTGCCCCTAAGTGGG + Intronic
1015200077 6:130569692-130569714 TGCTCTGTGGGTCTCTAAGAAGG - Intergenic
1015311406 6:131770976-131770998 TGTCCTGCGTGTCCCAAACAAGG - Intergenic
1019388484 7:772116-772138 TGCTGTGCGGGTGCCCAAGAGGG + Intronic
1019555975 7:1631599-1631621 TGCTATGCTTGCCCCTATGATGG - Intergenic
1023155383 7:37245865-37245887 TGCTCAGCGTGTCCCTGATGTGG - Intronic
1023727792 7:43162465-43162487 TCCTCTGCGTGTCCCTCACAAGG + Intronic
1032379929 7:131468061-131468083 TCCTCTGCCTGTCCCTCAAATGG - Intronic
1033523011 7:142181632-142181654 GGCTCAGGCTGTCCCTAAGAGGG - Intronic
1035097276 7:156365734-156365756 TGCTCTGCGTCTCCCTGGGAAGG + Intergenic
1037765355 8:21769173-21769195 TGCTCTGTGTGTTCCGGAGACGG - Intronic
1037788189 8:21915278-21915300 TGCTCTGGCAGCCCCTAAGATGG - Intergenic
1044773475 8:95662441-95662463 TGCTCTTCCTGCCCCTGAGAAGG - Intergenic
1053162158 9:35820615-35820637 TGCTCTCTGTGTACCTAAGAAGG + Intronic
1055731896 9:79287164-79287186 TGCTCTGCGGCTGCCTAAGCTGG - Intergenic
1059429107 9:114239553-114239575 TGCTCTGTGGGGCCCTAAGGAGG + Intronic
1185709389 X:2290924-2290946 CGCTCAGCGTGGCCCAAAGAAGG + Intronic
1191661822 X:63659322-63659344 TGCTCACCGTGTCCCTGTGAAGG - Intronic
1193726064 X:85041114-85041136 AGCTCTGCATTTCCCTGAGATGG - Intronic
1196686012 X:118510946-118510968 TGTTCTATGTGTCTCTAAGATGG - Intronic