ID: 1112202925

View in Genome Browser
Species Human (GRCh38)
Location 13:97295002-97295024
Sequence ATGTTATGGTATCATTGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 197}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112202920_1112202925 -2 Left 1112202920 13:97294981-97295003 CCCAGTTATTGCCAGTTTGAAAT 0: 1
1: 0
2: 2
3: 11
4: 198
Right 1112202925 13:97295002-97295024 ATGTTATGGTATCATTGTGAGGG 0: 1
1: 0
2: 0
3: 21
4: 197
1112202917_1112202925 13 Left 1112202917 13:97294966-97294988 CCCAGTTATTAACCACCCAGTTA 0: 1
1: 0
2: 0
3: 12
4: 94
Right 1112202925 13:97295002-97295024 ATGTTATGGTATCATTGTGAGGG 0: 1
1: 0
2: 0
3: 21
4: 197
1112202919_1112202925 1 Left 1112202919 13:97294978-97295000 CCACCCAGTTATTGCCAGTTTGA 0: 1
1: 0
2: 2
3: 5
4: 141
Right 1112202925 13:97295002-97295024 ATGTTATGGTATCATTGTGAGGG 0: 1
1: 0
2: 0
3: 21
4: 197
1112202918_1112202925 12 Left 1112202918 13:97294967-97294989 CCAGTTATTAACCACCCAGTTAT 0: 1
1: 0
2: 2
3: 11
4: 168
Right 1112202925 13:97295002-97295024 ATGTTATGGTATCATTGTGAGGG 0: 1
1: 0
2: 0
3: 21
4: 197
1112202921_1112202925 -3 Left 1112202921 13:97294982-97295004 CCAGTTATTGCCAGTTTGAAATG 0: 1
1: 0
2: 1
3: 14
4: 174
Right 1112202925 13:97295002-97295024 ATGTTATGGTATCATTGTGAGGG 0: 1
1: 0
2: 0
3: 21
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112202925 Original CRISPR ATGTTATGGTATCATTGTGA GGG Intronic
900664159 1:3802910-3802932 GTGTTTTGGTATTAGTGTGAAGG + Intergenic
907604322 1:55801700-55801722 ATCTTATGATATTTTTGTGATGG + Intergenic
908183998 1:61634316-61634338 AGGGTATGGTATCATAGAGAGGG - Intergenic
909861837 1:80616148-80616170 ATTTTATGGTTTCTTTGTGTTGG + Intergenic
910405044 1:86879822-86879844 ATGTTAAAGGATAATTGTGAAGG - Intronic
912602700 1:110953873-110953895 ATGTTATGGATTAATTATGAAGG - Intronic
913327376 1:117638671-117638693 ATGTTAGGGTCTCATTGGCAGGG + Intergenic
915422185 1:155791862-155791884 ATGTTATGTTATTTTTGAGATGG - Intronic
917238499 1:172920476-172920498 GTGTTTTGGTTTCATAGTGAAGG - Intergenic
919523506 1:198618974-198618996 ATGTGATGTTATTATAGTGACGG - Intergenic
921039747 1:211418396-211418418 ATTTTATGTGATAATTGTGATGG + Intergenic
923470601 1:234287286-234287308 ATCTTAAGGAATTATTGTGAAGG - Intronic
1063174227 10:3537130-3537152 TTGTTATGGCTTCATTGTTAGGG - Intergenic
1063442915 10:6088267-6088289 ATGGGATGGTATGATTCTGAGGG - Intergenic
1066368085 10:34795888-34795910 ATGTTATGTTATTTTTGAGATGG - Intronic
1066547412 10:36515514-36515536 ATGTAATGCTATTATGGTGAGGG + Intergenic
1068146443 10:53077315-53077337 AAGGTATGGTATCATTGTTGTGG + Intergenic
1068184884 10:53572595-53572617 ATATTATTGTATCATTGGAAGGG + Intergenic
1068329052 10:55537971-55537993 GTGTGATTTTATCATTGTGAAGG - Intronic
1070160312 10:73862888-73862910 ACCTAATGGGATCATTGTGAGGG - Intronic
1071477765 10:86039398-86039420 ATGTTAATGAATCATTATGAGGG + Intronic
1071559982 10:86638207-86638229 ATGTGTTTGTATCCTTGTGATGG + Intergenic
1072575075 10:96691799-96691821 TAGTTATGGTAACATTGGGAAGG + Intronic
1072924917 10:99608722-99608744 GTGTGATGATATCATTGTAAAGG - Intergenic
1077791257 11:5442524-5442546 ATGTTATCGCATCTTTATGATGG - Intronic
1078588216 11:12613027-12613049 ATGTATTTGTATCATTTTGAGGG - Intergenic
1079044210 11:17085427-17085449 CTGTAATGGTAACAGTGTGAAGG - Intronic
1079236424 11:18693967-18693989 ATGTTCTGATAACAGTGTGAGGG - Intronic
1080127904 11:28758979-28759001 ATATCATGGTATAATTGTGCTGG + Intergenic
1081277007 11:41162594-41162616 ATGTTATTGTATCATATTGTAGG + Intronic
1085452535 11:76643753-76643775 ATGTTAATGTATCTTTGTAATGG + Intergenic
1090740629 11:129656913-129656935 AGGTTATGGTATCAGGATGATGG - Intergenic
1092934513 12:13348033-13348055 TGCTTATGGGATCATTGTGAGGG - Intergenic
1093435187 12:19128967-19128989 ATTTTATGGAGTCCTTGTGACGG - Intergenic
1093518382 12:20018472-20018494 ATGTCATTCTTTCATTGTGATGG + Intergenic
1093715732 12:22379082-22379104 ATGTTGTTGTATCATTTTAAAGG + Intronic
1096244637 12:49977405-49977427 ATCTTAGGGTACCATGGTGATGG - Intronic
1097348461 12:58521342-58521364 ATGTTATGAGATCATGGAGAAGG + Intergenic
1098149578 12:67532531-67532553 ATGTTATGGTAAAAATGTGAAGG + Intergenic
1098556548 12:71825041-71825063 AGGTTATGGTATTTTTGTTATGG + Intergenic
1098879849 12:75905957-75905979 ATGACCTGGTATCAATGTGAGGG - Intergenic
1099065232 12:77968799-77968821 ATGTGCTTGTATCAGTGTGATGG + Intronic
1099873733 12:88379644-88379666 ATTTTATGGTATGATTTTAATGG + Intergenic
1099906289 12:88775324-88775346 ATGTTATGGTATAAGACTGATGG - Intergenic
1103066764 12:117905175-117905197 ATGTTATGTTATTTTTGAGATGG - Intronic
1103258023 12:119559970-119559992 ATGTTTAGGTTTCATTGTGTAGG + Intergenic
1105317543 13:19280394-19280416 AGGTTTTGGTATCAGTTTGATGG - Intergenic
1105389589 13:19962296-19962318 ATGCTCTGGTATTAATGTGATGG + Intronic
1108301068 13:49076599-49076621 ACCTTATAGGATCATTGTGAAGG + Intronic
1112202925 13:97295002-97295024 ATGTTATGGTATCATTGTGAGGG + Intronic
1112367728 13:98769970-98769992 AATGTATGGTCTCATTGTGAAGG + Intergenic
1112831784 13:103461569-103461591 ATGTTATTGTATCATTTTAGTGG + Intergenic
1113269109 13:108654049-108654071 ATGTTTTTGTATCCTTGTGTAGG + Intronic
1114021557 14:18484209-18484231 GTGTTCTGGAATCTTTGTGAGGG - Intergenic
1114023082 14:18498786-18498808 GTGTTCTGGAATCTTTGTGAGGG - Intergenic
1114023114 14:18499168-18499190 GTGTTCTGGAATAATTGTGAGGG - Intergenic
1114024713 14:18514476-18514498 CTGTTCTGGAATCCTTGTGATGG - Intergenic
1115167062 14:30460448-30460470 ATTATTTGGTATCATTGTGATGG + Intergenic
1115916248 14:38318480-38318502 ATGTTCTGGTGTCCTTGAGACGG - Intergenic
1116992600 14:51291983-51292005 ATGTTATGGGAACCTTGTCAGGG - Intergenic
1119689222 14:76657771-76657793 AAGTTGTGGAATCCTTGTGAGGG - Intergenic
1119947094 14:78706252-78706274 ATGCTAAGGTATAATAGTGAAGG + Intronic
1124165290 15:27320639-27320661 ATGTTATTAAATCATTGTCATGG + Intronic
1125036680 15:35133203-35133225 ATGTTATGGAAGCAGTGTCAAGG + Intergenic
1126063165 15:44803688-44803710 AACTTATAGCATCATTGTGATGG - Intergenic
1126209985 15:46091063-46091085 TTGTCATGGTAACATTGTCATGG + Intergenic
1126230949 15:46323724-46323746 ATGTTTGGGTACCATTGTTATGG - Intergenic
1126516560 15:49545784-49545806 ATGTATTGGTATCATTTTGAGGG + Intronic
1127878760 15:63136774-63136796 GTTTTATGGTACCATTTTGAGGG + Intronic
1129022311 15:72532555-72532577 AGGTTATGATATCTTTATGAAGG - Intronic
1137648706 16:50099269-50099291 AGCTTATGGGATCAGTGTGATGG + Intronic
1138227431 16:55309496-55309518 ATCTCATGGTATTATTGTGAGGG - Intergenic
1139162617 16:64529464-64529486 ATGTAATGGAAACATTGTTATGG - Intergenic
1145278137 17:21448260-21448282 ATCTTTTGGTATCATGGTGGAGG + Intergenic
1151617461 17:75223390-75223412 ATGTTATGTTATTTTTGAGATGG + Intronic
1151767767 17:76140932-76140954 ATGATAGGGGATCATTGGGAAGG + Intronic
1152283008 17:79396459-79396481 TTCTTCTGGTATCATTGTGCTGG - Intronic
1156198205 18:34799935-34799957 ATGTTTTGCTAACATTGTGGAGG + Intronic
1158330498 18:56357145-56357167 ATGTTAGGGCAGGATTGTGAGGG - Intergenic
1159352886 18:67298661-67298683 ATGTCATGGTCTCATTGCCATGG + Intergenic
1159400520 18:67927130-67927152 ATGCTATGGTAACATTATGCTGG - Intergenic
1159420229 18:68208933-68208955 AAGTTATGGTTTCAATTTGATGG - Intergenic
1159864148 18:73684655-73684677 AATTTATGGTATCAATGTCATGG + Intergenic
1167830355 19:52015041-52015063 ATATTATGGAATCATTGGCAAGG + Exonic
1168606315 19:57762912-57762934 GTTTTATGGTATAATGGTGATGG - Intergenic
926438974 2:12867497-12867519 ATGTTATAGACTCATTGTCAGGG + Intergenic
929842937 2:45489609-45489631 CTGTTATTGTATCATGATGATGG - Intronic
930572893 2:53109374-53109396 ATGTTTTGGGATCATTGATAGGG + Intergenic
931194080 2:60034107-60034129 ATGTAATGTTATCATTGATATGG + Intergenic
932034031 2:68222320-68222342 ATAAAATGGTATCATTGTGATGG + Intronic
932197111 2:69794565-69794587 ATGTTATGTTATTTTTGAGACGG + Intronic
933406225 2:81863360-81863382 ATGTTATGCCAAAATTGTGATGG + Intergenic
936247451 2:110840837-110840859 AGCTTATGGGATCAGTGTGAAGG + Intronic
936382405 2:111998072-111998094 ATGTTCTAGTAGCATTCTGAAGG - Intronic
936708725 2:115106088-115106110 CTGTTTTGGCATCATTGTGATGG + Intronic
936719770 2:115237025-115237047 AAGTTATATTATTATTGTGATGG - Intronic
940309633 2:152264007-152264029 ATGTTATGATTTCAATATGATGG + Intergenic
941212440 2:162657966-162657988 ATGTTATGGCATCAGGGTGTGGG + Intronic
941830824 2:169957245-169957267 ATGTTATGGTAACACTGTATTGG + Intronic
941881508 2:170485178-170485200 TTGTTATGGTTTTATTGTAATGG - Intronic
944284023 2:197927456-197927478 ATGTTCTTCTATCATTTTGAGGG + Intronic
945208331 2:207356104-207356126 ATGTTATGGCATTATTCTCAAGG + Intergenic
946887310 2:224234874-224234896 ATGTTATTGTATGGTTTTGATGG + Intergenic
1170012998 20:11747948-11747970 AGGTTTTGGTTTTATTGTGAAGG - Intergenic
1173259940 20:41425009-41425031 TTGTGATGGTATCATGGTGATGG - Intronic
1176344129 21:5725537-5725559 AGGTTTTGGTATCATTATGATGG + Intergenic
1176350943 21:5846121-5846143 AGGTTTTGGTATCATTATGATGG + Intergenic
1176500698 21:7598919-7598941 AGGTTTTGGTATCATTATGATGG - Intergenic
1176538450 21:8123606-8123628 AGGTTTTGGTATCATTATGATGG + Intergenic
1178168859 21:30015657-30015679 ATGTTTAGGTATCATTTTGGAGG + Intergenic
1180446017 22:15414555-15414577 GTGTTCTGGAATCTTTGTGAGGG - Intergenic
1180447186 22:15425742-15425764 GTGTTCTGGAATCTTTGTGAGGG - Intergenic
1180447218 22:15426124-15426146 GTGTTCTGGAATAATTGTGAGGG - Intergenic
1180448873 22:15441957-15441979 CTGTTCTGGAATCCTTGTGATGG - Intergenic
1183692561 22:39399082-39399104 ATGTTATGTTATTTTTGAGACGG - Intergenic
949920640 3:8997432-8997454 ATGTGATTGTATGATTGTAAAGG - Intronic
951194173 3:19804986-19805008 AGGTTTTGGTATCAGGGTGATGG - Intergenic
951376260 3:21922004-21922026 AGGTTTTGTTATCATGGTGATGG - Intronic
956141935 3:66154869-66154891 ATCTCATGGAATCATTTTGAAGG + Intronic
956997444 3:74844038-74844060 AACTTATGGAATCATTGGGAAGG + Intergenic
957920195 3:86736773-86736795 ATGTTATGTTAACTTTTTGAGGG - Intergenic
959843215 3:111002255-111002277 ATGTTTTGGTATCAGGATGATGG - Intergenic
964829478 3:160867757-160867779 GTGGCATGGTATCATTGTAAAGG + Intronic
965552399 3:169981157-169981179 ATATGATGGTAGCATTTTGAGGG + Intronic
965844756 3:172948070-172948092 AAGTTCTGTTATCATTTTGAAGG - Intronic
967500386 3:190190816-190190838 ATGGTATAGTTTCAGTGTGAAGG - Intergenic
967759431 3:193206640-193206662 AGGTGATTGTATCATTGGGATGG + Intergenic
968200452 3:196749764-196749786 ATGTCATGTTATCATTGTTTTGG + Intronic
970362597 4:15324635-15324657 ATGTTATAATATCCCTGTGAAGG - Intergenic
971558170 4:28039968-28039990 ATGATATGGTATCTTATTGAGGG - Intergenic
971566573 4:28150857-28150879 ATGTTATGTTTTCATTGTAAGGG + Intergenic
972268826 4:37489322-37489344 ATGCTATGGTCTCATTTTGGGGG + Intronic
975377968 4:73667406-73667428 GTGTTTTGGTATTAGTGTGAAGG + Intergenic
977101311 4:92818913-92818935 ATGCTATAGAATTATTGTGAAGG - Intronic
977129783 4:93221597-93221619 ATAGTTTGGTATTATTGTGAAGG + Intronic
977179905 4:93860508-93860530 ATGTATTTGTATAATTGTGAAGG - Intergenic
977382088 4:96288148-96288170 AAGTTATAAAATCATTGTGATGG + Intergenic
977581968 4:98735602-98735624 ATGTGATGGTATTTTTGTGTGGG - Intergenic
978873836 4:113613557-113613579 ATGTGATGCTATAATTTTGAGGG + Intronic
982618151 4:157667955-157667977 CTGTTCTGGTATCATAGTCATGG + Intergenic
983166466 4:164483111-164483133 TTGTTATGGAATCTTTATGAAGG + Intergenic
983292952 4:165829488-165829510 AGGTAATGCTATCATTGTTAGGG + Intergenic
983697552 4:170550710-170550732 ATGTTTTGATATCATTTTTAAGG + Intergenic
983822998 4:172220097-172220119 ATGTTATTTAATCATTTTGAAGG - Intronic
984323088 4:178218502-178218524 ATTTTATGTTATCATTGAGATGG + Intergenic
986467458 5:8040188-8040210 ATGTAATGGTATGGTTTTGAGGG + Intergenic
988365365 5:30291266-30291288 ATGTTATTGTGTCATTTTGCAGG + Intergenic
988825654 5:34931969-34931991 AATTTATGGCATCAGTGTGATGG + Intronic
992411518 5:76510326-76510348 ATGTTATTGGATCATTAAGAAGG + Intronic
992534967 5:77690798-77690820 ATGTTAGAGTTTCACTGTGAAGG + Intergenic
992708199 5:79420040-79420062 ATGTGATGCTAGTATTGTGACGG + Intronic
993511394 5:88775293-88775315 GTTTTATGGTATTAATGTGAAGG + Intronic
994254342 5:97575727-97575749 ATATTATGGTAATATTTTGATGG + Intergenic
994490149 5:100431445-100431467 ATGTTATGGTATCAGTAAGTTGG - Intergenic
995962281 5:117856917-117856939 ATGCTATGACATCATTGTAATGG - Intergenic
996032713 5:118723725-118723747 CTTTTATGGTATCATTCTGCAGG - Intergenic
996191494 5:120548726-120548748 ATTGTAATGTATCATTGTGAAGG + Intronic
996194307 5:120584851-120584873 GTCTTATGGGATCATTGGGAAGG - Intronic
996290537 5:121846842-121846864 ATGTCAAGGAATCAATGTGAGGG - Intergenic
996920521 5:128762603-128762625 CAATGATGGTATCATTGTGAGGG + Intronic
998888622 5:146721998-146722020 ACCTTATGGTTTTATTGTGAGGG - Intronic
999100998 5:149026306-149026328 ATCTTATAGTGTTATTGTGAAGG - Intronic
1004777423 6:18863566-18863588 ATGTTATTTTATCATTGTGGAGG + Intergenic
1004910917 6:20282695-20282717 AGGTTTTGGTATCAGGGTGATGG - Intergenic
1007241245 6:40426976-40426998 ATGTTATGGCCACAATGTGATGG - Intronic
1007357624 6:41332813-41332835 TTGTTATGGGACCATTGTCATGG + Intergenic
1008227712 6:48941870-48941892 ATCTTATGGCATCATTATGCAGG - Intergenic
1012242604 6:96890988-96891010 ATTTAATGCTCTCATTGTGAGGG - Exonic
1013466734 6:110424223-110424245 TTTTTATGGTTTAATTGTGAAGG + Intergenic
1014507466 6:122277572-122277594 ATGTGATGGCTTCATTCTGAAGG - Intergenic
1016160659 6:140875621-140875643 ATGTTATTTTTTCATTGTGAGGG - Intergenic
1016492309 6:144620150-144620172 ATTTAATGAGATCATTGTGATGG + Intronic
1016717706 6:147252968-147252990 AGGTTGTGGTATCAGGGTGATGG - Intronic
1017212287 6:151870374-151870396 ACTATATGGTATCATTGGGAGGG - Intronic
1017237038 6:152127327-152127349 ATGTCATGGGATTCTTGTGAGGG + Intronic
1020593812 7:10178607-10178629 AAGGTATGGTATAATTTTGAAGG - Intergenic
1021433385 7:20586943-20586965 ATTTTATAGTATCGTTTTGACGG - Intergenic
1021773583 7:24029475-24029497 ATGTTCTGGAATTAATGTGATGG + Intergenic
1022909641 7:34888209-34888231 GTGATAAGGTGTCATTGTGAGGG + Intergenic
1024379908 7:48684907-48684929 AAGCTATGGGCTCATTGTGAAGG - Intergenic
1024890963 7:54203133-54203155 CTGGTATGGTATCATTTTGTAGG + Intergenic
1025924147 7:65943019-65943041 AAATTATGGTATAATTGGGAGGG + Intronic
1025931474 7:65998116-65998138 AAATTATGGTATAATTGGGAGGG + Intergenic
1026357594 7:69572835-69572857 ATTTCACGGTGTCATTGTGAAGG - Intergenic
1027172154 7:75880018-75880040 ACGTCATGGGATCCTTGTGAGGG - Intronic
1027703345 7:81496952-81496974 ATCTTATGGTATTTTTGTTATGG + Intergenic
1029345781 7:99977532-99977554 GTGTTTTGGTATTAGTGTGAAGG - Intergenic
1030343315 7:108405448-108405470 ACCTTATGGGATTATTGTGAGGG - Intronic
1030776725 7:113542933-113542955 ATAGTATGTTTTCATTGTGACGG - Intergenic
1031308942 7:120169228-120169250 ATGTGATGGTATTATGGGGACGG - Intergenic
1032303648 7:130712759-130712781 ATGGTATGGTACCAGTCTGAAGG - Intergenic
1034168633 7:149045482-149045504 TGGTTATGGTATCATTTTGATGG + Intergenic
1040644053 8:49377740-49377762 ATGTTATGTTATTGTAGTGATGG + Intergenic
1042796964 8:72674995-72675017 ATGTTATGGTTTCACTTTGCTGG + Intronic
1042946885 8:74164062-74164084 GTGTTATAGTCTCATTATGATGG - Intergenic
1044474511 8:92610399-92610421 ATTATATGGAATCATTTTGAAGG + Intergenic
1046800042 8:118416176-118416198 ATGTTATGCTATGATTTAGATGG - Intronic
1049881192 8:145064819-145064841 GTGTTTTGGTATTAGTGTGAAGG - Intergenic
1050281744 9:4057386-4057408 ATGTTATGATATCTTTATTAGGG - Intronic
1051232532 9:14967605-14967627 ATATTATGATATCATAGAGAAGG + Intergenic
1051349578 9:16186333-16186355 ATCTCATAGTGTCATTGTGAGGG - Intergenic
1051645099 9:19260400-19260422 ATGTTATGTTATTTTTGAGATGG + Intronic
1052185139 9:25584595-25584617 ATGTTTTGGTATCAGGATGATGG - Intergenic
1052286847 9:26795804-26795826 ATGGTATGGTATCATTTATATGG + Intergenic
1052577329 9:30306896-30306918 ATGATATGGCACCATTTTGAGGG + Intergenic
1055251046 9:74305919-74305941 ATGTTATTGTCTCAGTGTTATGG - Intergenic
1055474250 9:76645778-76645800 ATGTCTTGGAATTATTGTGAAGG - Intronic
1058415936 9:104788660-104788682 ATGTATTGGTATCTTTGTAATGG - Intronic
1059576856 9:115498654-115498676 ATATTATGGTAGCATTATTAAGG - Intergenic
1188431666 X:30110384-30110406 ATTTTGTGGTGTCATTATGATGG - Intergenic
1189247084 X:39571644-39571666 AAGTTATGCTTTCATGGTGATGG - Intergenic
1189597866 X:42589243-42589265 AGGTTTTGGTATCAGAGTGATGG - Intergenic
1193665079 X:84306558-84306580 ATGTCATGGTATGATTGCTAGGG - Intergenic
1194184824 X:90763514-90763536 ATGTTATGTTCTCATTATGAAGG - Intergenic
1195536169 X:106011733-106011755 AGGTAATGGAATCATGGTGAGGG + Intergenic
1198759296 X:140015184-140015206 CTGTTATGATTTCATTGTGACGG - Intergenic
1198779440 X:140218393-140218415 CTGTTATGATTTCATTGTGATGG + Intergenic
1200270763 X:154680439-154680461 ATGGTATGGTTTCATTGCGAAGG - Intronic
1200531443 Y:4345603-4345625 ATGTTATGCTCTCATTATGAAGG - Intergenic