ID: 1112203404

View in Genome Browser
Species Human (GRCh38)
Location 13:97300680-97300702
Sequence TAGTGGAGTAAAGATGTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 182}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112203404_1112203409 23 Left 1112203404 13:97300680-97300702 CCTTCAACATCTTTACTCCACTA 0: 1
1: 0
2: 0
3: 14
4: 182
Right 1112203409 13:97300726-97300748 ATTGATCTGCTTCAAAAATTTGG 0: 1
1: 0
2: 1
3: 20
4: 266
1112203404_1112203410 24 Left 1112203404 13:97300680-97300702 CCTTCAACATCTTTACTCCACTA 0: 1
1: 0
2: 0
3: 14
4: 182
Right 1112203410 13:97300727-97300749 TTGATCTGCTTCAAAAATTTGGG 0: 1
1: 0
2: 3
3: 19
4: 289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112203404 Original CRISPR TAGTGGAGTAAAGATGTTGA AGG (reversed) Intronic
906862430 1:49376083-49376105 AGGTGGAGTTAAGATGTAGAGGG - Intronic
907267170 1:53269616-53269638 TATTTGAGTAAAGAAGGTGAAGG - Intronic
907375243 1:54032583-54032605 TAGGAGAGCTAAGATGTTGAAGG - Intronic
908129902 1:61064711-61064733 TAGTGGAGGAAAGAAATTAAAGG + Intronic
909141544 1:71872806-71872828 TATTGAAGTTAAGATTTTGATGG + Intronic
909269528 1:73604730-73604752 CAGTGGAGTAGAGATGCAGATGG - Intergenic
910677820 1:89832538-89832560 TAGTGCAGTAAGGATCTTTATGG + Intronic
911374551 1:97036025-97036047 TAGTTGAGGAAACATGTTAATGG + Intergenic
912085415 1:105996414-105996436 TATTGGAGGTAAGATGTAGAGGG - Intergenic
919268811 1:195311593-195311615 TTGTGGAGTAAAAACTTTGAAGG - Intergenic
921993183 1:221389535-221389557 TAGGGGAATAAAGATTTTGGGGG + Intergenic
1063021716 10:2135723-2135745 TACTGGAGTGAAGATGTTTTAGG - Intergenic
1064923325 10:20542562-20542584 AAATGGAGTAAGGATTTTGAAGG + Intergenic
1066067038 10:31769525-31769547 TAGTTTAGTAAAAATGTTTAGGG + Intergenic
1066555302 10:36606234-36606256 TTTTGGGGTAAAGTTGTTGAAGG - Intergenic
1071661063 10:87503712-87503734 AAAAGGAGTAAAGATGGTGATGG + Intergenic
1072856522 10:98953093-98953115 TAGTTGAAAAAAGATGCTGAAGG + Intronic
1075534122 10:123255775-123255797 TGGTGGTGTAATGATGGTGATGG - Intergenic
1075580133 10:123611408-123611430 TGGTGGTGTGAAGATGATGATGG - Intergenic
1076726328 10:132415809-132415831 TAGAGGATTATAGATGTTGCCGG + Intronic
1078675802 11:13412575-13412597 TTCTGGAGTAAAGATGTAGTAGG - Intronic
1079395584 11:20060302-20060324 TAGTGGAGGAATTATGTTGGAGG - Intronic
1082931149 11:58606776-58606798 AAGGTGAGTAAAGATGTTTAAGG - Intronic
1085229439 11:74952053-74952075 AAGTAGAGGAAAGCTGTTGAAGG + Intronic
1085506163 11:77061036-77061058 TAGTGGGGTAAAGATGTTTTGGG + Intergenic
1085749559 11:79149202-79149224 CAGTGGAGTAAAGAGAGTGAGGG + Intronic
1085872264 11:80364344-80364366 TGGTGGAGTAAAGATTTAAATGG + Intergenic
1089355977 11:117854152-117854174 GACTGGAGTCAAGATGTGGAAGG + Intronic
1096429181 12:51529290-51529312 CTGTGGAGTGAAGATGATGAAGG - Intergenic
1098772703 12:74574751-74574773 TATTTGAGTAAAGATATTTATGG - Intergenic
1100163486 12:91889598-91889620 TAGTGGAGGGAAGATGTCCATGG + Intergenic
1100814158 12:98369501-98369523 GAGTTGAATAAAGAAGTTGATGG - Intergenic
1101883948 12:108645410-108645432 TAATGAAGTAAAGTTGTTGATGG - Exonic
1102410821 12:112716744-112716766 TAGGGGAGGAAAGATGTTGGGGG + Intronic
1102940903 12:116940748-116940770 TAGTTGAGTAGCCATGTTGATGG + Intronic
1104400679 12:128473510-128473532 TGGTGGAGTGAAGATGAAGATGG - Intronic
1105683398 13:22752472-22752494 GAGTGGGGAAAAGATGTTGGGGG - Intergenic
1107114303 13:36730327-36730349 TAGTGGAGAAAAGATTTTATTGG - Intergenic
1107272743 13:38639518-38639540 TAGTGGAGTGACAATTTTGATGG - Intergenic
1109482612 13:62975188-62975210 TAGTGGAATCAAAATGTTCATGG - Intergenic
1110317837 13:74131972-74131994 TAGTGGAAATAGGATGTTGAAGG - Intronic
1110495360 13:76161738-76161760 CAGTGTAGTAAAGCTGTTGAAGG - Intergenic
1112203404 13:97300680-97300702 TAGTGGAGTAAAGATGTTGAAGG - Intronic
1112765008 13:102732275-102732297 TCGTGGAGTAAAGATGTCTCAGG - Exonic
1112985150 13:105439555-105439577 TTGTTGAGTCAAGATGTAGATGG - Intergenic
1113002163 13:105653399-105653421 TAGTGGAAGAAATATGTTGTTGG - Intergenic
1116996005 14:51325598-51325620 GAGGAGAGTAAAGATGTTTATGG - Intergenic
1117997889 14:61495141-61495163 TAGTGGAGTGAACATCCTGAGGG + Intronic
1119956537 14:78804213-78804235 AAGTGGAGGCAAAATGTTGATGG + Intronic
1122604734 14:102940565-102940587 TACTACAGTACAGATGTTGAAGG + Intronic
1124122145 15:26896690-26896712 CACTGGCCTAAAGATGTTGAGGG + Intronic
1125141381 15:36411738-36411760 TATTTAAGTAAAGATTTTGAGGG - Intergenic
1126418192 15:48441168-48441190 TATTTGAGTAAAGATTTTCAAGG - Intronic
1128721802 15:69955644-69955666 TAGTGGAGAAGTGATGTTGTTGG + Intergenic
1129511056 15:76122879-76122901 AAGTGGAAAAAAGATATTGAGGG + Intronic
1130153810 15:81332717-81332739 TCGTGGAATGAAGATTTTGAGGG - Exonic
1133558614 16:6928962-6928984 TTGGGAAGTAAAGATGTTCACGG + Intronic
1133941761 16:10315316-10315338 TAGTGCAGTTCATATGTTGATGG + Intergenic
1134589346 16:15439653-15439675 TAGTGGAAAAACGCTGTTGAAGG - Intronic
1135057796 16:19245019-19245041 TCGTGGAGCAAGCATGTTGAAGG - Intronic
1137434935 16:48447388-48447410 TGGGGGAATACAGATGTTGATGG + Intronic
1139005476 16:62565762-62565784 TTGTGAAATCAAGATGTTGATGG + Intergenic
1139665092 16:68449333-68449355 AAGTGGAGTCCAGATCTTGAAGG - Intergenic
1140260960 16:73379203-73379225 TGGAGGAGTAAAGGTGTTAAGGG + Intergenic
1141289600 16:82705473-82705495 TAGTTGAGTAAAGATTCAGATGG - Intronic
1143570980 17:7758434-7758456 AAGTGGAGGAAAGATCTTCAGGG + Intronic
1145917599 17:28584914-28584936 TGCTGAAGTAAAGATGCTGAAGG + Intronic
1149482327 17:57013772-57013794 AAATGAAGTAATGATGTTGACGG - Intergenic
1155198942 18:23500994-23501016 CAGTGCAGCAAGGATGTTGAAGG + Intergenic
1155344969 18:24848857-24848879 TAGGGAAGAACAGATGTTGAGGG - Intergenic
1159248033 18:65835441-65835463 TAGAGGAGAAAGGATGATGAGGG - Intronic
1162183968 19:8890252-8890274 TGGTGGTGTAATGATGATGATGG - Intronic
925997425 2:9304623-9304645 TAGTGGAGTATAGATATTGGTGG + Intronic
925997440 2:9304691-9304713 TAGTGGGGTATAGATATTGGTGG + Intronic
925997459 2:9304760-9304782 TAGTGGGGTATAGATATTGGTGG + Intronic
925997482 2:9304863-9304885 TAGTGGGGTATAGATATTGGTGG + Intronic
925997502 2:9304966-9304988 TAGTGGGGTATAGATATTGGTGG + Intronic
925997508 2:9305000-9305022 TAGTGGGGTAAAGATATTGGTGG + Intronic
925997530 2:9305101-9305123 TAGTGGGGTACAGATATTGGTGG + Intronic
925997539 2:9305136-9305158 TAGTGGGGTATAGATATTGGTGG + Intronic
925997569 2:9305303-9305325 TAGTGGGGTATAGATGTTGGTGG + Intronic
925997577 2:9305337-9305359 TAGTGGGGTATAGATATTGGAGG + Intronic
925997591 2:9305402-9305424 TAGTGGGGTATAGATATTGGTGG + Intronic
925997602 2:9305470-9305492 TAGTGGGGTATAGATATTGGTGG + Intronic
925997608 2:9305504-9305526 TAGTGGGGTATAGATATTGGTGG + Intronic
925997616 2:9305538-9305560 TAGTGGGGTACAGATATTGGTGG + Intronic
925997642 2:9305671-9305693 TAGTGGGGTATAGATATTGGTGG + Intronic
925997648 2:9305705-9305727 TAGTGGGGTATAGATATTGGTGG + Intronic
925997654 2:9305739-9305761 TAGTGGGGTATAGATATTGGTGG + Intronic
925997684 2:9305906-9305928 TAGTGGGGTATAGATATTGGTGG + Intronic
925997692 2:9305940-9305962 TAGTGGGGTACAGATATTGGTGG + Intronic
928664744 2:33539203-33539225 TAGTGGAGGTAAGTGGTTGAGGG + Exonic
929122134 2:38492128-38492150 CTGTGGAGTAATGATGATGACGG - Intergenic
929697351 2:44129615-44129637 TAGTGGAAAAAAGATTTTGCTGG + Intergenic
932067630 2:68583266-68583288 TAGGGTAGTAAAGCTGTTGCAGG - Intronic
933901111 2:86850681-86850703 TAGTGGAGTAAGGCTGGGGATGG - Intronic
935779435 2:106498553-106498575 TAGTGGAGTAAGGCTGGGGATGG + Intergenic
936404846 2:112193784-112193806 TAGTGGTGTAAAGCTTTGGATGG + Intergenic
937144260 2:119628859-119628881 TAATGGGGTGAAGAGGTTGATGG + Intronic
937703442 2:124890644-124890666 TAGTGGAATAAACATATTGTTGG - Intronic
938026191 2:127950865-127950887 TGGTGGAGCAAAGAGGTGGAAGG + Intronic
938142471 2:128807906-128807928 TAGTAGAGTGGAGATGATGAAGG - Intergenic
938605239 2:132885541-132885563 TAGTGGTCTAAATATGTTCATGG + Intronic
941354833 2:164477816-164477838 TTGTAGAATAAATATGTTGATGG - Intergenic
941920336 2:170844121-170844143 TGGTCAAGTAAAGATGGTGATGG + Exonic
942807581 2:179950842-179950864 TATAGAAGTAAAGAAGTTGATGG + Exonic
943831571 2:192470817-192470839 TAGGGGAGGCAAGATGATGATGG + Intergenic
945228504 2:207558540-207558562 TAGTTAAGGAAAGATGATGAAGG - Intronic
945633084 2:212308610-212308632 TTGAGGGGAAAAGATGTTGAGGG - Intronic
946927759 2:224642737-224642759 TTGTGGAGTAAAGATGAAGAAGG + Intergenic
1168783619 20:517505-517527 TGGTGGTGTACAGACGTTGAAGG + Intronic
1173117431 20:40258793-40258815 TAATGGATGAAAGAAGTTGAAGG + Intergenic
1173679412 20:44866846-44866868 GAATGGAGAAAAGATGTTGAAGG - Intergenic
1175165034 20:57037534-57037556 TCGTGGGGGAAAGATGCTGATGG - Intergenic
1177139541 21:17343485-17343507 TAGTGGAGCAGAGATGCTGGTGG - Intergenic
1178108870 21:29350731-29350753 GAGGGGAGCAAAGAGGTTGAGGG + Intronic
1179468888 21:41597480-41597502 GAGTGGAGAGAAGTTGTTGAAGG - Intergenic
1183326675 22:37198260-37198282 TAGAGGAGTCAAGATATGGAAGG - Intronic
1184938863 22:47746140-47746162 TAGAGAAGCAAAGATGATGATGG - Intergenic
949098213 3:112078-112100 TTTTTGAGTAAAGATGTTGTAGG + Intergenic
951441790 3:22731935-22731957 TAGTAGACTGATGATGTTGATGG + Intergenic
951975550 3:28503472-28503494 GAATGGAGTGAAGATGATGATGG - Intronic
954946343 3:54427943-54427965 CAGTGGAGAAATCATGTTGAGGG - Intronic
955474073 3:59317414-59317436 TTGTGGAGTGAAGAAATTGAGGG + Intergenic
956405495 3:68924676-68924698 TTGTTGAGTAAGGATGTTGCTGG - Intronic
957491687 3:80935199-80935221 TAGAGGAGAAATGATGTTTAAGG - Intergenic
957854112 3:85851059-85851081 TAGTGGGGGAAAGACTTTGAGGG - Intronic
959810427 3:110612835-110612857 TAGTGGAGGAGAGATTTTCAGGG - Intergenic
960576505 3:119235285-119235307 TAGTGGAGTAAAAATGTGTGTGG - Intronic
962757639 3:138478679-138478701 AAGAGGAGTTAAAATGTTGAAGG + Intronic
962888809 3:139653025-139653047 TAATGGAGTTAAAATGTTAAAGG + Intronic
962900278 3:139755747-139755769 GAGTGGGGTAAAGATGTAGGGGG + Intergenic
963656017 3:148051031-148051053 TATTGGGGAAAAGATGTTAAAGG - Intergenic
964260267 3:154827575-154827597 TAGTGGCTTAAACATGTTGGAGG - Intergenic
965157528 3:165083439-165083461 TAGTGGAGTAAAAAGTTAGAAGG + Intergenic
965596616 3:170417581-170417603 TGGTGGCTTAATGATGTTGATGG + Intergenic
971132038 4:23822270-23822292 GAATGGAGAGAAGATGTTGATGG - Intronic
973138904 4:46741620-46741642 TAGTTCAGGAAAAATGTTGATGG - Intronic
979622930 4:122815802-122815824 CAGTGGAGTGAAAGTGTTGAAGG - Intergenic
980987544 4:139710337-139710359 TAGTGCAGTAAGTATGGTGATGG - Intronic
981780983 4:148428729-148428751 TTCTGGAGTAAAGATGTTGGGGG - Intronic
985314313 4:188638529-188638551 AAGTGGAGTTAAAATGTTGTAGG - Intergenic
986641740 5:9878744-9878766 TTGTGTATGAAAGATGTTGATGG - Intergenic
989605192 5:43237785-43237807 TAGTGGAATAAAAAAGTAGAAGG - Intronic
990409628 5:55528006-55528028 GAGTGGAGAAAAGATCTGGAAGG + Intronic
992164996 5:74040704-74040726 TAGGGGAGGAAAGACATTGAGGG - Intergenic
992557613 5:77918438-77918460 TAGTGTATTAAAAATATTGATGG - Intergenic
993007229 5:82441657-82441679 TAGGGGAGTAAAGGTGGTGGAGG + Intergenic
993401430 5:87457457-87457479 TAGTGGAGGAAATAAGTTGATGG + Intergenic
995198265 5:109397822-109397844 TAGTGGTTTAAAGTTGTTGTTGG - Intronic
997089257 5:130837745-130837767 TAGTGAAGTAAAGATGAAGGTGG - Intergenic
998420876 5:141985236-141985258 TAGTTCAGTAAAAATGTTAAGGG - Intronic
998813176 5:145986570-145986592 TGGTGGAGAAGAGATGGTGACGG + Intronic
998971056 5:147593015-147593037 AAGAGGCGTAAAGATATTGATGG + Intronic
1003958344 6:11186914-11186936 TAGAAAAGTAAAGCTGTTGAAGG - Intronic
1007297678 6:40838908-40838930 TAGTGGAATAAAGATTTCCAAGG + Intergenic
1011544451 6:88468626-88468648 CAATGGAAAAAAGATGTTGAAGG + Intergenic
1011560650 6:88610787-88610809 TAATGGAGTTAAAATGTTTATGG - Exonic
1011928126 6:92673493-92673515 TAGTGAAGAAAAAATGTTAAAGG + Intergenic
1014512386 6:122340018-122340040 TAGTGGAATAAAGAAGTAAAAGG - Intergenic
1016756535 6:147693595-147693617 AAGTGGAGGAATGATGTTTAAGG + Intronic
1018622429 6:165743296-165743318 CAGTGGAGGAAAGAAGGTGATGG - Intronic
1020790220 7:12618021-12618043 TATTAGAGGATAGATGTTGAAGG - Intronic
1021289535 7:18825532-18825554 TAGTGGACTAATGAGGTTGGAGG + Intronic
1021758133 7:23875739-23875761 TGGTTGAGTAAGGAAGTTGAGGG + Intergenic
1022404853 7:30079308-30079330 CTGTGTAGTAAAGATGTTCAGGG + Exonic
1024586626 7:50847608-50847630 TAGTGGAGTAGTGATTTCGAAGG + Intergenic
1027424602 7:78049630-78049652 AAGTGGAGAAAAGGTGTTAAAGG - Intronic
1027520909 7:79205734-79205756 GAGTGGAGGAAAAATGTAGAGGG + Intronic
1028656742 7:93217569-93217591 CAGAGGAGTAAAGATGCAGAAGG - Intronic
1028986533 7:97013379-97013401 AAGTGGAGGAAAGATGTCGAAGG + Intergenic
1031575163 7:123407127-123407149 TAGAGGTGTAAGGATGTAGAAGG - Intergenic
1032211986 7:129923928-129923950 GAGTTGAGTCAAGATGTTAATGG - Intronic
1032712433 7:134472170-134472192 TAGTGGATCAGAGATCTTGATGG + Intergenic
1039166745 8:34689429-34689451 AAGTGGAGTAACAATGGTGAGGG - Intergenic
1039876391 8:41590059-41590081 TAATGGAGTCCAGATCTTGATGG + Intronic
1040725147 8:50373886-50373908 CAGTGGAGTAAAGGTGTTGGTGG - Intronic
1041722992 8:60993148-60993170 AAGTGGTGTACAGATGATGACGG + Intergenic
1043704209 8:83328999-83329021 TGGTGGAGTAAGGACCTTGATGG - Intergenic
1043772834 8:84226258-84226280 TAGTGGGGTATAGATGGGGATGG - Intronic
1043972158 8:86542916-86542938 TATTTGAGTAAAGATTATGAAGG - Intronic
1045617093 8:103929345-103929367 TAAAGGAGAAAAAATGTTGATGG + Intronic
1052985941 9:34487889-34487911 TGGTGGAGTAGAGAGGTAGATGG + Intronic
1053146888 9:35718120-35718142 AAGTGGAGTAAAGAAGCTGGGGG - Intronic
1056267461 9:84913331-84913353 AAGTGGAATAAAGATGATTAAGG - Intronic
1058666129 9:107317622-107317644 CAGAGGGGTAAAGATGTTGGTGG + Intronic
1058930288 9:109712223-109712245 TAGTTAAATAAAGATGTTAAAGG + Intronic
1061051529 9:128198968-128198990 TGATGGAGTCAAGATGTAGACGG - Intronic
1188144260 X:26590185-26590207 TTGTGGTGTAAAGATGTAGATGG + Intergenic
1188633781 X:32402238-32402260 TAATGGAGTGAAAAAGTTGATGG + Intronic
1188786582 X:34353838-34353860 TAGTGCACTAAATTTGTTGAAGG + Intergenic
1188842556 X:35034502-35034524 TAATGCTGTAAAGATTTTGAGGG - Intergenic
1191864777 X:65695121-65695143 TGGTGGAGTATAGATGCAGAGGG + Intronic
1194983083 X:100460363-100460385 TAGTGGGGTAGAGCAGTTGAAGG + Intergenic
1196478383 X:116114597-116114619 TTGTGAATTAAAGATGATGATGG + Intergenic
1197288720 X:124628183-124628205 AAGTGGATTAAAGATGGAGAAGG - Intronic
1197311928 X:124915829-124915851 TACTGGAAAAAAGATTTTGAAGG + Intronic