ID: 1112204039

View in Genome Browser
Species Human (GRCh38)
Location 13:97306424-97306446
Sequence TTGAAGAAGAGGAAAGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1686
Summary {0: 1, 1: 0, 2: 10, 3: 199, 4: 1476}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112204039_1112204044 26 Left 1112204039 13:97306424-97306446 CCATCTTCTTTCCTCTTCTTCAA 0: 1
1: 0
2: 10
3: 199
4: 1476
Right 1112204044 13:97306473-97306495 ACCCTCTGAGAGCAAACTCATGG 0: 1
1: 0
2: 1
3: 14
4: 126
1112204039_1112204047 29 Left 1112204039 13:97306424-97306446 CCATCTTCTTTCCTCTTCTTCAA 0: 1
1: 0
2: 10
3: 199
4: 1476
Right 1112204047 13:97306476-97306498 CTCTGAGAGCAAACTCATGGTGG 0: 1
1: 0
2: 2
3: 7
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112204039 Original CRISPR TTGAAGAAGAGGAAAGAAGA TGG (reversed) Intronic
900766409 1:4508866-4508888 AAGAAGAAGAGAAGAGAAGAGGG - Intergenic
900920920 1:5669885-5669907 TTGATGAAGACGAGTGAAGACGG + Intergenic
901082667 1:6592466-6592488 TAGAAGAAGTGGGAAGAAGAAGG - Exonic
901128557 1:6947253-6947275 TTGAAAAAGCGAAAAGAAGTTGG - Intronic
901284552 1:8066704-8066726 AAGAAGAAGAAGAAAGAAGGAGG - Intergenic
901769016 1:11521250-11521272 GGGGAGAGGAGGAAAGAAGAGGG + Intronic
902058222 1:13619773-13619795 TTCAGGAAGAGCAAAGAAAAAGG - Intergenic
902079166 1:13809364-13809386 TGGTAGAAGAGGAAGGAAGGCGG + Intronic
902390137 1:16098975-16098997 TTTAAAAAGAGGAGAGGAGAAGG + Intergenic
902984972 1:20149600-20149622 GTGAAGGAGAGGGGAGAAGATGG + Exonic
903049600 1:20590816-20590838 TTGGAGAAGCAGAAGGAAGAGGG + Intronic
903090965 1:20916659-20916681 TTGAAAAAGAAGAATGAAGTTGG + Intronic
903458033 1:23502095-23502117 GAGAAGAAGAAGAAAGAAGAAGG - Intergenic
904367729 1:30026286-30026308 TTGAAAAAGAAGAATGAAGCTGG + Intergenic
905014727 1:34769976-34769998 GAGAAGAATAGGAAACAAGAGGG + Intronic
905090228 1:35424898-35424920 TTAATGAAGAGGAAAAAAAAAGG - Intergenic
905305109 1:37012393-37012415 TGGCTGAAGAGGAAAAAAGATGG + Intronic
905324753 1:37143410-37143432 GGGAAGAAGAGGAGAGAGGAGGG + Intergenic
905345314 1:37307255-37307277 TTGGGGAGGAGGAAAGAAGGAGG + Intergenic
905400443 1:37698661-37698683 TGGAAGAAGAGATAAGAAAATGG + Intronic
905742617 1:40385652-40385674 TTGAAGAAAAGGAAAAGAAAAGG - Intronic
905765095 1:40593856-40593878 GAGAAGAAAAAGAAAGAAGAGGG - Intergenic
905970189 1:42135979-42136001 TTGTAGAACAGAAAGGAAGAAGG - Intergenic
905978519 1:42200450-42200472 TTGAAGAAAAGGATAAAACATGG - Intronic
906111628 1:43327011-43327033 TTGAAACAGAGGAATGAAGTTGG + Intergenic
906180817 1:43817339-43817361 AAGAAGAAGAAGAAGGAAGAAGG - Intronic
906546616 1:46623963-46623985 TTGAAAAAGAGATAAGAAGGAGG + Intergenic
906554707 1:46699880-46699902 TCCAAGGAGAGCAAAGAAGAAGG - Intronic
906784494 1:48602829-48602851 AAGAAGAAAAGGAATGAAGAGGG - Intronic
907380044 1:54079627-54079649 GTGAAGAAGAGGCAGAAAGATGG - Intronic
907408661 1:54269664-54269686 TTCAAGAAGGGGAGAGGAGAAGG + Intronic
907488076 1:54790819-54790841 GAGAAGAAGAAGGAAGAAGAAGG - Intronic
907802337 1:57782301-57782323 ATGAAGAATATGAAAAAAGAGGG + Intronic
908117709 1:60956454-60956476 TTTCAGCAGATGAAAGAAGAGGG + Intronic
908391416 1:63686913-63686935 ATGAAGAAGTGGATGGAAGAAGG - Intergenic
908474278 1:64472289-64472311 GGAAAGAAGAGGAAGGAAGAAGG - Intronic
908516973 1:64902787-64902809 TTGAAGAAGAGGAAGGACAATGG - Intronic
908940592 1:69428212-69428234 TTCAGGAAGAGGACAGAGGAAGG - Intergenic
909273030 1:73648742-73648764 GTGAAGAAGAGCAGAGAAGAGGG - Intergenic
910700244 1:90066075-90066097 TTGATGGAGAGGACAGAAGTGGG + Intergenic
910774851 1:90864513-90864535 AAGAAGAAGAAGAAAGAAGGTGG - Intergenic
910774852 1:90864516-90864538 TAGAAGAAGAAGAAGAAAGAAGG - Intergenic
910934566 1:92476682-92476704 TTCAAGAACAAGAAAGAAGACGG - Intronic
911109082 1:94164048-94164070 TTGAGGAAGAGGAATGTGGATGG - Intronic
911147716 1:94568637-94568659 GTGAGGAAGAGGAAAGAATATGG + Intergenic
911201007 1:95043708-95043730 GGGAAGGAGAGGAAAGAGGAAGG + Intronic
911204942 1:95082602-95082624 TTGAAGAAAAAGCAAGAAAAAGG - Intergenic
911303234 1:96201852-96201874 TTGAAGAAGAGAAATGAAGGTGG + Intergenic
911386347 1:97179917-97179939 AAGAAGAAAAGGAAAGGAGATGG + Intronic
911663246 1:100527150-100527172 AAGAAGAAGAAGAAAGAAGAAGG - Intergenic
911741653 1:101392627-101392649 AAAAAGAAGAGGAAAGAAGAGGG - Intergenic
911877166 1:103181635-103181657 TTGAATCAGAGGGTAGAAGATGG - Intergenic
912226572 1:107741020-107741042 ATGAAAAAGAGGAGAGAGGAGGG + Intronic
912616326 1:111103333-111103355 TTGAAGAAGTGGAGTGAAGAAGG - Intergenic
912750641 1:112284344-112284366 TTGAAAAAAAGAAAAGAAAAAGG + Intergenic
912752961 1:112300703-112300725 TGGAAGAAGAGGAGAAAAGAGGG + Intergenic
912953770 1:114138164-114138186 GTCAAGAAGAGGAAGGAAAAGGG - Intronic
913419653 1:118651275-118651297 CTGAAGAATAGGAATGAAAATGG - Intergenic
913437976 1:118866740-118866762 GAGAAGAAGGGGAAGGAAGAAGG + Intergenic
913535667 1:119769693-119769715 TAGTAGAAGAGCAAAGCAGAAGG - Intergenic
914960099 1:152197470-152197492 AAAAAGAAGAAGAAAGAAGAAGG - Intergenic
915086314 1:153391242-153391264 TAGGAGAAGCGGAAAGAGGAAGG + Intergenic
915652235 1:157323053-157323075 TTGAAAAAGAGGAATAAAAATGG + Intergenic
915794537 1:158715011-158715033 TTGAAGAAGAGGATGGACCAGGG - Intergenic
916346546 1:163798050-163798072 TTGAAGAACAGGAAGGAAGAAGG - Intergenic
916508452 1:165449533-165449555 TTGAATAAGTGGAAAGAGCATGG + Intergenic
916582994 1:166125000-166125022 TTAAAGAATAGGAAACAAGTTGG - Intronic
916602385 1:166305840-166305862 CTGAAGAGGAGCAAAGAAGTGGG + Intergenic
916616378 1:166445534-166445556 TAGAAGAAGAAGAAGGAAGGAGG + Intergenic
916882336 1:169032026-169032048 AAGAAGAAGAAGGAAGAAGAAGG - Intergenic
916991762 1:170251895-170251917 TTTATGAAGAAGAAAGAACATGG - Intergenic
917306954 1:173636998-173637020 AAGAAGAAGAGTAAAGAAGAAGG + Intronic
917409380 1:174742214-174742236 AAGAAGAAGAAGAAAGAAAAGGG + Intronic
917452884 1:175161855-175161877 ATGAGGAAGAGGAAGGTAGAAGG - Intronic
917672785 1:177288987-177289009 TTGAAGAAGAGGCAAGGGAAGGG + Intergenic
917737192 1:177932196-177932218 GTGAAGACGTGGAAAGAAGATGG + Intronic
917837870 1:178954992-178955014 TTGAAGAAGAGAACAGAGGCTGG - Intergenic
917894740 1:179476943-179476965 TGGAAGTAGAGAAAAGAAAAAGG - Intronic
917913215 1:179673591-179673613 TTGAAGCAAAGGCAAGAAGCAGG + Intronic
918053252 1:180993633-180993655 TTGAATAGGAGGAAAGAGAAAGG + Intronic
918168263 1:181971215-181971237 TTGAAGAAAAGAAAAACAGAGGG + Intergenic
918331120 1:183461502-183461524 TTGAGAAAGAAGAAAGAATAGGG - Intergenic
918477987 1:184946465-184946487 CTCAAAAAGAGGAAAGAGGAAGG + Intronic
918604766 1:186409945-186409967 TAGAAGAACAGCATAGAAGAGGG - Intronic
918762311 1:188427026-188427048 TTGATCAAGAGGAAAAATGAAGG + Intergenic
919112216 1:193235280-193235302 TTGGAGAAGAGAAAGGAGGAAGG - Intronic
919147474 1:193654134-193654156 TAGAAGAAGAGAAAAGAAAAAGG - Intergenic
919575360 1:199302201-199302223 TTGAAGTAGAGGGAACAACATGG + Intergenic
920063258 1:203244020-203244042 AGGAAGAAGAAGAAAGAAAAAGG + Intronic
920127222 1:203702998-203703020 TTGGGGAAGAGGGAAGAAGCTGG - Intronic
920210440 1:204324308-204324330 CTGAAGTAGAGGATAGAATAGGG + Intronic
920212491 1:204338472-204338494 GTGAAAAAGGGGAAAGCAGATGG + Intronic
920224717 1:204430074-204430096 GTGAAGATGGGGAAAGAAAATGG + Intronic
920275337 1:204800263-204800285 GTGAAGAGGTGGAAAGGAGAGGG + Intergenic
920703163 1:208233024-208233046 TTCAAGCAGAGGCTAGAAGATGG - Intronic
921253620 1:213320050-213320072 TAGAAGAAGAGGGTAGAATAAGG + Intergenic
921798934 1:219379934-219379956 GTGAAGAAGAGGCAGGAAGGAGG + Intergenic
921990639 1:221362443-221362465 TTTTAGAAGAGGAACAAAGAAGG - Intergenic
922306215 1:224347135-224347157 TTGAAAAAGAGCAAAGTTGAAGG - Intergenic
922510422 1:226161566-226161588 GGGAGGAAGAGGAAAGGAGACGG - Exonic
922569517 1:226625726-226625748 GTGAAGCAGAGGAGAGATGATGG - Intergenic
923302705 1:232656796-232656818 TTGAATAAGAGGACTGTAGACGG - Intergenic
923331185 1:232926363-232926385 TTCAAGAAGAGAACAGAAGAGGG + Intergenic
923378668 1:233392609-233392631 GAGAAGAAGAAGAAAGAAGAAGG - Intergenic
923576314 1:235161904-235161926 TTGCAGAAGGGGAAAGAGGAGGG - Intronic
923668109 1:236016372-236016394 GTGAGGAAGAGGCAAGAAGATGG + Intronic
923714243 1:236411512-236411534 AAGAAGAAGAAGAAAGAAGAAGG - Intronic
923763941 1:236874662-236874684 GTGAGGAAGATGAAAGAAAAAGG - Intronic
923818629 1:237408620-237408642 TTGAAGGAGAAGAACGAAGTTGG - Intronic
924107899 1:240667700-240667722 GTGAAGACGAAGAATGAAGAGGG - Intergenic
924214270 1:241804357-241804379 TTGAAGAAGAAGAATAAAGTTGG + Intergenic
924787828 1:247216855-247216877 TTGAAAAAGAGCAAAGCAGAGGG - Intergenic
924797016 1:247300034-247300056 TTGGACTAGAGGAAAGAAGAAGG - Exonic
1063312477 10:4967426-4967448 CTTAAAAAGAGGCAAGAAGATGG - Intronic
1063440794 10:6071423-6071445 TGGAGGAAGAGGAAGGAGGAGGG - Intergenic
1063525536 10:6781169-6781191 TTAAAGAAAAGAAAAGAAAAAGG - Intergenic
1063545822 10:6980513-6980535 CAAAAAAAGAGGAAAGAAGAAGG - Intergenic
1063873513 10:10446025-10446047 ATGAAGAGGAGGAAAATAGAGGG + Intergenic
1063946780 10:11184339-11184361 TTGAAAATGAGGAACGAAGTTGG - Intronic
1064096847 10:12430043-12430065 ATGAAGCAGAGGAAATCAGAAGG - Intronic
1064151709 10:12871125-12871147 TGGAAAATGAGGAAGGAAGAAGG + Intergenic
1064237456 10:13588644-13588666 TTGAAGAAGAGAGAAGGAGGAGG - Intronic
1064534958 10:16349313-16349335 TTCAAGATGAGGAGGGAAGAGGG - Intergenic
1064928697 10:20599128-20599150 ATGTAAAAGAGGAAATAAGAGGG - Intergenic
1064940376 10:20727818-20727840 ATGAATAAGAGGAAAGCAGCAGG + Intergenic
1064994592 10:21285443-21285465 TTGAAGCAAAGGCAGGAAGATGG - Intergenic
1065043099 10:21717542-21717564 AGAAAGAAGAAGAAAGAAGAAGG - Intronic
1065229178 10:23579511-23579533 TTGAGCAAAAGGAAAGAGGAGGG + Intergenic
1065445072 10:25789772-25789794 TTGAAGAAGAAAAAATAAAAGGG - Intergenic
1065457634 10:25923872-25923894 AGGAAGAAGAGGAAAAAAGGAGG - Intergenic
1065480993 10:26193670-26193692 TAGAAGAAAAGGAAAGAAGAGGG + Intronic
1065698830 10:28404897-28404919 TTGAAGAAAAAAAAAAAAGAAGG + Intergenic
1065780587 10:29162868-29162890 GTGTAGAGGAGGAGAGAAGAAGG + Intergenic
1065866449 10:29919189-29919211 AGGAAGAAGAGGAGAGAGGAGGG - Intergenic
1066153826 10:32653376-32653398 TTGAAGGAGAGGAAAGTATCAGG - Intronic
1066501484 10:35999365-35999387 TTGCAGAAAAAAAAAGAAGACGG - Intergenic
1067264524 10:44726859-44726881 TTGGAGAAGAACAAAGAAGAAGG - Intergenic
1067301567 10:45015179-45015201 TTGAAGAGGAGGAGCCAAGATGG - Intergenic
1067361529 10:45584830-45584852 TTGAAGATGAAGAAAGAAAGAGG + Intronic
1067906838 10:50300388-50300410 TTGAATAAGAGTGAAGAAAATGG - Intergenic
1068534749 10:58229701-58229723 ATGAAAAAGAGGAAAGAAAGAGG + Intronic
1068751081 10:60593006-60593028 TTCAAAAAGAGGGAAGAAAAAGG - Intronic
1068752305 10:60609050-60609072 TTGAAGAAAAGGAAAGAGGAAGG + Intronic
1068975298 10:63002544-63002566 TTGGATAAGCTGAAAGAAGAGGG - Intergenic
1069080094 10:64079454-64079476 TTGACTAAGTGGAGAGAAGAGGG + Intergenic
1069473066 10:68710317-68710339 AAAAAGAAGAAGAAAGAAGAAGG - Intergenic
1069561320 10:69432451-69432473 GTGGAGAAGAGGAGAGAATAGGG - Intergenic
1069574225 10:69515519-69515541 TTGCAGGAGAGGAAAGATAAAGG + Intergenic
1069636257 10:69926707-69926729 TGGGAGAAGAGGAAAGAACAAGG + Intronic
1070090980 10:73285411-73285433 TTGAAGGACAGAAAAGTAGATGG + Intronic
1070091626 10:73291565-73291587 TTGAAGAAGAGAAAGGAAAAAGG + Intronic
1070647715 10:78212957-78212979 ATGAGGAAGAGGAAAGAAGAGGG - Intergenic
1070852500 10:79577766-79577788 TTGAAGAAGAGTAAAGTTGGAGG + Intergenic
1070974965 10:80599274-80599296 CTGAAGGAGAAGACAGAAGAAGG + Intronic
1071156061 10:82691046-82691068 TTCCAGATGAGGGAAGAAGAGGG - Intronic
1071227585 10:83548487-83548509 TTTAAAAAGAGAAGAGAAGAAGG - Intergenic
1071274218 10:84038092-84038114 TTGAAGAAGAGGAATAGGGAGGG + Intergenic
1071318984 10:84433151-84433173 TTGAAGAAGAAGAAAGTCGAAGG - Intronic
1071663003 10:87524736-87524758 CTGGAGGAGAGGAAAGAGGATGG + Intronic
1071877817 10:89861504-89861526 AGGCAGAAGAAGAAAGAAGAAGG - Intergenic
1071887588 10:89967838-89967860 AGGAAAAAGAGGAAAGAAGGAGG - Intergenic
1071958266 10:90782553-90782575 TTGAAGTATAGGAAAGGTGATGG - Intronic
1071988396 10:91075567-91075589 TTGGACAAGAGGAAAGAGAAGGG + Intergenic
1072085758 10:92077750-92077772 GGGAAGAAGAGGAGAGAGGATGG + Intronic
1072165103 10:92805628-92805650 TTAAAGAGGAGGAAAAGAGAAGG - Intergenic
1072227757 10:93386283-93386305 ATTAAGAAAAGGAAAAAAGAGGG - Intronic
1072975950 10:100058007-100058029 ATGAAGAAAAGAAAAAAAGAAGG - Intronic
1073666857 10:105543451-105543473 AGGAACAAGAGGATAGAAGATGG + Intergenic
1074129302 10:110559137-110559159 TTCACGAAGAGGAAGGATGAAGG - Intergenic
1074142998 10:110692207-110692229 TTGAAAAAGAGGAACAAAGTTGG - Intronic
1074350341 10:112730618-112730640 TGGAAAAAGAAGAAAAAAGAGGG - Intronic
1074388556 10:113037130-113037152 TTGTAGAAGATGAAGGAAGCTGG + Intronic
1074577489 10:114684210-114684232 TTAAAGATGAGGAAAGATGCAGG - Intronic
1074598322 10:114887984-114888006 TGGAAGGAGAGGAAAGGAGAGGG + Intronic
1074656154 10:115589901-115589923 ATAAAGAAGAGCAATGAAGATGG - Intronic
1075246488 10:120827053-120827075 TTGAAGAAGAAGAAAAAAAAAGG + Intergenic
1075489328 10:122853089-122853111 TTGAATAGGTGGAGAGAAGAAGG - Intronic
1075577559 10:123589293-123589315 TTAAAGGAGAGGAAAAAAGTGGG - Intergenic
1075838605 10:125477672-125477694 AGGGAGAGGAGGAAAGAAGAAGG + Intergenic
1075864573 10:125706615-125706637 TTGAAGAAGATGACAGGAGATGG + Intergenic
1076034243 10:127185674-127185696 TTAGAGAAGTGGAAAGGAGAAGG + Intronic
1076108064 10:127840268-127840290 TTGCTGAAGATGGAAGAAGAAGG + Intergenic
1076150892 10:128161252-128161274 CTGCAGAAGAGTAAAGAGGAAGG - Intergenic
1076599504 10:131647790-131647812 TTGAGGCAGAGGAAGGGAGACGG - Intergenic
1077651353 11:3975624-3975646 AAGAAGAAGAAGAAGGAAGAAGG + Intronic
1078431236 11:11290320-11290342 TTCTAGAAAAGGAAAGAAGCAGG - Intronic
1078543338 11:12228853-12228875 TGGGAGCAGAGGAGAGAAGATGG + Intronic
1078653554 11:13217663-13217685 AGGAGGAAGAGGAAAAAAGAAGG - Intergenic
1078887705 11:15521410-15521432 TTGGAGAGGATGTAAGAAGAGGG - Intergenic
1078901653 11:15648257-15648279 ATGAAGCAGGGTAAAGAAGAGGG - Intergenic
1079387319 11:19992084-19992106 TAGGAGAAGAGGAAAGGGGATGG - Intronic
1079431827 11:20397486-20397508 TTGAGGAAGAGGAAAGGGGAGGG - Intronic
1079645156 11:22853703-22853725 AGGAAGAAGAAGAAAGAAGAAGG + Intronic
1079652879 11:22951763-22951785 CTGAGAAAGAAGAAAGAAGATGG - Intergenic
1079975024 11:27080264-27080286 TAGAAGAGGAGGAAAATAGAAGG - Intronic
1080233091 11:30039931-30039953 AGGAAGAAGAAGAAGGAAGAAGG + Intergenic
1080386069 11:31811817-31811839 TGGAAGAAGAGGAAAGGGGCGGG + Intronic
1080683554 11:34497055-34497077 TTGAAGAATCAGAAAGAGGATGG + Intronic
1080820984 11:35806366-35806388 GTGAAGAAGAGGACACATGAAGG + Exonic
1080876799 11:36282195-36282217 TGGAAGGAGATGATAGAAGAGGG + Intronic
1080951172 11:37034685-37034707 TTTATAAAGAGGAAAGAAGGAGG - Intergenic
1081031821 11:38094036-38094058 GTGAAGAAAAGAAAAGAAAATGG + Intergenic
1081105035 11:39056432-39056454 TAGAAGAAAAGGAAATAACAGGG + Intergenic
1081307235 11:41528019-41528041 TTAAAAAAGAGTAAAAAAGATGG - Intergenic
1081430407 11:42970477-42970499 TTGAAAGGGAGGAAAGAAGGTGG - Intergenic
1081540001 11:44027565-44027587 CTGAAAAAGGGGAAAGAAGAAGG - Intergenic
1081858153 11:46316823-46316845 TTCCAGAAGAAGATAGAAGAGGG - Intronic
1082020694 11:47530656-47530678 TTTAAGAAGAGGAAAAAGGCTGG + Intronic
1082664310 11:55955528-55955550 TTGAAGAAGAGTAAAGAGGGAGG - Intergenic
1082868899 11:57925213-57925235 TTGAAGACGACGCAAGAAAATGG + Intergenic
1083516857 11:63267941-63267963 AAGAAGAAGAAAAAAGAAGAAGG - Intronic
1084023296 11:66431387-66431409 AGAAAGAAAAGGAAAGAAGAAGG + Intergenic
1084297088 11:68219622-68219644 AAGAAGAAGAGGAGAGAGGAAGG - Intergenic
1085249194 11:75130997-75131019 TTAAAGAAGAAAGAAGAAGAAGG + Intronic
1085405541 11:76259666-76259688 CAGAGGAAGAGGAAGGAAGAAGG + Intergenic
1085700041 11:78737656-78737678 TTGGAGAAAAGGAAAAAAGGAGG - Intronic
1085763987 11:79266458-79266480 TTGAAGAAGAGGAATGATACAGG + Intronic
1085807668 11:79651109-79651131 AAGAAGAAGAAGAAAGAAGGAGG - Intergenic
1086144962 11:83541610-83541632 GTGGAGATGAGGGAAGAAGAAGG - Intronic
1086586293 11:88456293-88456315 ATGATGAAGAGGGAAGAGGAGGG - Intergenic
1086673554 11:89575751-89575773 ATGAAGTAGAAGAAAGAAGAAGG - Intergenic
1087114348 11:94508705-94508727 TTGAAAAATAAGAAAGAAGTTGG - Intergenic
1087533836 11:99418418-99418440 TTAAAGACCTGGAAAGAAGAGGG + Intronic
1088207109 11:107404831-107404853 GAGTAGAAGAGGAAAGTAGAGGG - Intronic
1088288360 11:108209945-108209967 TAGAAAAAGAGCAAAGCAGAAGG + Intronic
1088430203 11:109750424-109750446 CTGAGGAAGGGGACAGAAGATGG - Intergenic
1088753577 11:112866323-112866345 TAGGAGAAGTGGAAGGAAGAGGG - Intergenic
1088763479 11:112954074-112954096 TTGAAAAAGAAGAATGAAGTTGG + Intergenic
1088808486 11:113372984-113373006 TTGGAAGAGAGGAAAGGAGAAGG - Intronic
1088813847 11:113408614-113408636 GAGAAGCAGAGGAAAGAAGAAGG - Intergenic
1089097024 11:115927690-115927712 TTCGAGAAGCTGAAAGAAGATGG + Intergenic
1089368191 11:117933935-117933957 TGGATAAAGAGGAAAGAGGAGGG + Intergenic
1089739353 11:120571678-120571700 AGGAAGAAGAGGAGAGATGAGGG - Intronic
1089753732 11:120670498-120670520 TTGAGGAAAAGCAAAGAAGCTGG - Intronic
1090241643 11:125187153-125187175 TTGAAAAAGAGGAACAAAGTTGG - Intronic
1090464631 11:126923312-126923334 AGGAAGAAGAAGAAGGAAGAAGG - Intronic
1090464639 11:126923369-126923391 AGGAAGAAGAAGAAGGAAGAAGG - Intronic
1090992017 11:131826294-131826316 TGGCAGAAGAGGGAAGAAGAAGG + Intronic
1091008653 11:131977783-131977805 TCGAAGAAAAGGAAAAAAAAGGG + Intronic
1091164885 11:133466774-133466796 GTGAAGAGGAAGAAAGAAGAAGG + Intronic
1091203465 11:133800669-133800691 TTGAAGAAGAGCAGCGCAGAAGG + Intergenic
1091285202 11:134405051-134405073 GGGAAGAGGAGGGAAGAAGAAGG + Intronic
1091337223 11:134781514-134781536 GTGGAAAAGAGGAAAGAAGAGGG - Intergenic
1091372380 11:135071796-135071818 TTGAAAAAAACGAAAGGAGAGGG + Intergenic
1091509426 12:1107155-1107177 GAGAAGAAGAGGAACAAAGAAGG - Intronic
1091947542 12:4561916-4561938 TTGAAGAAGGGGAGAGAGTAGGG + Intergenic
1092034005 12:5315006-5315028 TTTAAAAAGGGGAAAGAGGAAGG - Intergenic
1092213958 12:6667540-6667562 TTGAAGAAGAGTTCAGAAAAAGG + Exonic
1092222346 12:6723689-6723711 GTGAAGAAGAGGGAAAAAAACGG - Intergenic
1092244483 12:6855993-6856015 TGGAAGGATAGGGAAGAAGAGGG - Intronic
1092307259 12:7314140-7314162 ATGTAGAAGATGAAGGAAGAAGG + Intronic
1092358485 12:7816531-7816553 GTGAAGAAGAAAAAAGAAGATGG - Intronic
1092611648 12:10179358-10179380 AAGAAAAACAGGAAAGAAGAGGG + Intronic
1092656973 12:10696162-10696184 TTGAAGAAGTTGCAAGAGGAAGG - Intergenic
1092927314 12:13283053-13283075 GTGAAGAACAGGAAAGGGGAGGG + Intergenic
1092969546 12:13678982-13679004 AGGAAGAAAAGGAAAGAGGAAGG + Intronic
1092969551 12:13679017-13679039 AGGAAGAAAAGGAAAGAGGAAGG + Intronic
1093357118 12:18179612-18179634 TAAAAAAAGAAGAAAGAAGAAGG + Intronic
1093508408 12:19896805-19896827 AAGAAGAAGAAGGAAGAAGAAGG - Intergenic
1093622742 12:21311923-21311945 CTCAAAAAGAAGAAAGAAGAAGG + Intronic
1093752346 12:22814622-22814644 TTGTTGAAGAGGAAATAAAAAGG - Intergenic
1093859318 12:24143840-24143862 AAGAGGAGGAGGAAAGAAGAAGG + Intergenic
1093881239 12:24406471-24406493 TTGGGGCACAGGAAAGAAGAGGG - Intergenic
1094070294 12:26405149-26405171 AAGAAGAAGAAGAAAGAAGGAGG + Intronic
1094072151 12:26429370-26429392 TTGGAGATGGGGAAAGAAAAAGG + Intronic
1094083741 12:26566057-26566079 GAGAAGGAGAGGAAAGGAGAAGG + Intronic
1094129869 12:27063317-27063339 GAGAAGGAGAAGAAAGAAGAAGG - Intronic
1094129871 12:27063353-27063375 AGGAGGAAGAAGAAAGAAGAAGG - Intronic
1094146011 12:27229038-27229060 TTGCATAAAAGGTAAGAAGAAGG - Intergenic
1094337139 12:29372382-29372404 AAGAAGAAGAAGAAAGAAGGTGG + Intronic
1094432211 12:30381759-30381781 TTGAAGAAGAAGAACAAAGATGG + Intergenic
1094592354 12:31833532-31833554 TTGAGAAATAGGAAAGAAGAAGG - Intergenic
1094619064 12:32062724-32062746 AAGAAAAAGAGAAAAGAAGAAGG - Intergenic
1094631585 12:32180660-32180682 GTGAGGATTAGGAAAGAAGAAGG - Intronic
1094768242 12:33622405-33622427 TCAAAGAGAAGGAAAGAAGAGGG - Intergenic
1094794288 12:33952478-33952500 TTGAAAATGAGTAAGGAAGATGG - Intergenic
1095243362 12:39887620-39887642 TAGAAGAAGCTGTAAGAAGAAGG - Intronic
1095383893 12:41627818-41627840 TTGAAGAAAAGGAGAAAAGGTGG + Intergenic
1095449314 12:42313166-42313188 TTGAAGAAGAACAAAAAAAATGG - Exonic
1095480005 12:42625010-42625032 AGGAAGAAGAAGGAAGAAGAAGG - Intergenic
1095541481 12:43313339-43313361 TTGAAGAAAAAGGAAGAGGAGGG - Intergenic
1095562288 12:43580259-43580281 TCGAGGAAGAGGAAATGAGAAGG - Intergenic
1095960339 12:47830499-47830521 TTTTGGAAGAGGAAAGAGGAAGG - Intronic
1096298797 12:50407495-50407517 TTTTAAAAGAGGAATGAAGATGG + Intronic
1096542049 12:52313405-52313427 GTGAAGGGGAGGAATGAAGAGGG + Intergenic
1096923516 12:55115915-55115937 ATGAAGAAGAGGATTGCAGATGG - Intergenic
1096968109 12:55644647-55644669 TGAAAGAGGAGGAAAGAAGCAGG - Intergenic
1097069011 12:56341194-56341216 TTGAAAAAAAGAAAAGATGAGGG + Intergenic
1097345993 12:58493023-58493045 TTGAAGAAGAAAAATGAAGTTGG - Intergenic
1097360049 12:58648937-58648959 TTGTCAAAAAGGAAAGAAGAAGG - Intronic
1097449507 12:59718965-59718987 TTGAAAAAGACAAAAGAAGTGGG - Intronic
1097455187 12:59791718-59791740 TTGAAGAAGAATAAAGTTGAAGG - Intergenic
1097548054 12:61029439-61029461 GAGAAGAAGAAGGAAGAAGAAGG - Intergenic
1097623480 12:61971050-61971072 AAGAAGAAGTGGAAAGAAGCTGG + Intronic
1097676457 12:62607511-62607533 TTGAATAAGAGGAAAGAACTAGG - Intergenic
1097724831 12:63063578-63063600 TTGCAGAATAGAAAAGAAGATGG + Intergenic
1097809208 12:64000179-64000201 GTGAAGAGGAGGAAAGATAAGGG + Intronic
1097875061 12:64635690-64635712 TTTAAAAAGCGGTAAGAAGAGGG + Intronic
1097892241 12:64789161-64789183 AAGAAGAAGAAGGAAGAAGAAGG - Intronic
1097985227 12:65775893-65775915 TAGAGGAAGGGGAAAAAAGAAGG + Intergenic
1097995488 12:65883177-65883199 TGAAAGAAGAGGAAAGGCGATGG + Intronic
1098208763 12:68140117-68140139 TTGAAAAAGAGGAATAAAAATGG + Intergenic
1098213959 12:68196085-68196107 TTGCAGGAGTGGGAAGAAGAGGG + Intergenic
1098307335 12:69115284-69115306 AAGAAGAAAAGAAAAGAAGAAGG + Intergenic
1098523861 12:71464294-71464316 TTGAATAAGAGGAAGAAAGGAGG + Intronic
1098788873 12:74794830-74794852 TTGAGGAAGACGAAAAAAGAGGG + Intergenic
1098954128 12:76670955-76670977 TCTAAGAAGAGGAATGCAGATGG + Intergenic
1099099537 12:78421093-78421115 TTGAAGAAGCTGAAAATAGATGG - Intergenic
1099115415 12:78618128-78618150 TTAATTATGAGGAAAGAAGAAGG + Intergenic
1099163838 12:79276934-79276956 GAGAAGAAGAAGAAGGAAGAAGG + Intronic
1099208508 12:79756717-79756739 TTGGGGAAGAGGCAAGAACATGG - Intergenic
1099389291 12:82059372-82059394 GAGAAGAAAAGGGAAGAAGAAGG + Intergenic
1099448307 12:82778316-82778338 TTGAAGAACAGGGAAGATGGGGG - Intronic
1099534981 12:83832039-83832061 TTGAAAAAGTGAAAAGAAAAAGG - Intergenic
1099585765 12:84510363-84510385 TTGAAATAGGAGAAAGAAGAGGG - Intergenic
1099744602 12:86686374-86686396 TTGAATAGGAGTAAGGAAGAGGG + Intronic
1099935987 12:89125969-89125991 TTAAAAAAGAGGAAAGAGAAAGG - Intergenic
1099950044 12:89291825-89291847 CTGAAGAAGGAGAAAGAAGAGGG + Intergenic
1099975620 12:89542838-89542860 TTGAAGAAGAGGAGAGAGGTTGG - Intergenic
1100271076 12:93025228-93025250 TTCAAGCAGAGGAAAGATAACGG - Intergenic
1100438462 12:94593412-94593434 AAGAAGAAGAAGGAAGAAGAAGG + Intronic
1100835461 12:98562964-98562986 TTGAAGAAGAGCAAAGTTGGAGG + Intergenic
1100864436 12:98841740-98841762 TTCAAAAAGAGGAAAAAAAAAGG + Intronic
1100890991 12:99125675-99125697 TTGAAGTAAGGTAAAGAAGAGGG + Intronic
1101037017 12:100716556-100716578 ATGAAGCAGGGGAAAGAGGAAGG - Intergenic
1101062296 12:100984755-100984777 GTGAAAAAGAGGAAGCAAGAAGG - Intronic
1101173356 12:102122453-102122475 TAGAAGAAAAGGATAGCAGAAGG + Intronic
1101302883 12:103499516-103499538 ATGGAGAAGAGAAAGGAAGATGG + Intergenic
1101581781 12:106048364-106048386 TTGCAGAAGGGGAATGCAGAAGG - Intergenic
1101667910 12:106836902-106836924 CTGAAGAACAGTAAAGAAGTTGG - Intronic
1101728449 12:107407019-107407041 TTAAAGATGAGGAAATAGGAAGG - Intronic
1101793888 12:107955335-107955357 CTGAAGAAGATAAAAGAACAGGG - Intergenic
1101794108 12:107957020-107957042 AGGAAGAAGAAGGAAGAAGAAGG - Intergenic
1101846761 12:108369079-108369101 TGGAAGAAGAGAAAACAGGAGGG - Intergenic
1101917335 12:108905932-108905954 TTGAAAAAGAGGAACAAAGTTGG - Intergenic
1101941912 12:109105711-109105733 TGGAAAAAAAGGACAGAAGAGGG - Intronic
1102167964 12:110821038-110821060 GAGAAGAAGAAGAAAGAAGAAGG - Intergenic
1102724466 12:115048245-115048267 TTTTAAAACAGGAAAGAAGATGG + Intergenic
1102899266 12:116623721-116623743 TCAAAAAAGAAGAAAGAAGAAGG + Intergenic
1102974978 12:117200190-117200212 AAGGAGAAGAAGAAAGAAGAAGG - Intergenic
1103040336 12:117689984-117690006 AAGAAGAAAAGGAAGGAAGATGG + Intronic
1103044825 12:117727370-117727392 GTGAAGAAAAAGAAGGAAGAAGG + Intronic
1103044826 12:117727395-117727417 CAGAAAAAGAAGAAAGAAGAAGG + Intronic
1103219488 12:119231946-119231968 AGGAAGAAGAAGAAAGAAGGAGG - Intergenic
1104302376 12:127576085-127576107 TTGACAAAGATGAAAGATGAGGG - Intergenic
1104509993 12:129368538-129368560 AGGAAGGAGAGGAATGAAGAAGG - Intronic
1104591286 12:130086163-130086185 GTGAAGAAGAGCAGAGAAAAGGG - Intergenic
1104603913 12:130173437-130173459 TCAGAGAAGAGGAAAGAAAAAGG + Intergenic
1104738944 12:131158589-131158611 ATAGAGAAGAGGAAGGAAGAAGG - Intergenic
1104883627 12:132090223-132090245 AAGAAAAAGAGGAAAGAAAAAGG - Intronic
1104928970 12:132328542-132328564 TTGAAGGTGGGGAAAGAGGAGGG - Intronic
1105550067 13:21385554-21385576 ATGAAGCAGAGAAAAGAAGATGG + Intronic
1105607758 13:21941395-21941417 TTGGAGAAGAAAAAAGAAGTAGG - Intergenic
1105744563 13:23364728-23364750 TTGAAGGAGAGGAGAGAACAAGG - Intronic
1105775469 13:23655457-23655479 CTGAAGAAGTGGAAATAGGAAGG - Intronic
1105779262 13:23692113-23692135 GAGAAGCAGAAGAAAGAAGATGG + Intergenic
1105937012 13:25110696-25110718 TTGAAAAAGAAGAATAAAGATGG - Intergenic
1105967745 13:25399850-25399872 AAGAAGAAGATGAAAGAGGAGGG - Intronic
1106143561 13:27032336-27032358 TTGAAAAAGAAGAATGAAGTTGG + Intergenic
1106210782 13:27642503-27642525 TGGAAGAAGAGGAAAGACAAAGG - Intronic
1106321476 13:28643591-28643613 TTTAAGAATAGGAAAGAAACAGG - Intergenic
1106750698 13:32763388-32763410 GGGATGAAGAGGGAAGAAGATGG + Intronic
1106759393 13:32853007-32853029 ATGAATAAGAGGTAAGAAAATGG - Intergenic
1106767041 13:32923518-32923540 TTGAAGTAGGAGAAAGAAAATGG + Intergenic
1106979919 13:35267107-35267129 GTGGAGGAGAAGAAAGAAGAGGG + Intronic
1107078511 13:36348915-36348937 TTGAAAAAGAAGAATGAAGTTGG + Intronic
1107574073 13:41697883-41697905 TTGAATAAGAGGGAAGTAGGAGG - Intronic
1107633825 13:42371788-42371810 TAGAAGTAGAGGATAGAACAGGG - Intergenic
1107847566 13:44532811-44532833 ATGAATAAGAGGTAAGAATATGG + Intronic
1108011447 13:46017157-46017179 TTGAAAGTGAGAAAAGAAGATGG + Intronic
1108352991 13:49604256-49604278 TTGCAGAAGGGGAAAGAACAAGG + Intergenic
1108533827 13:51352049-51352071 TTGAAAAAGAAGAAAGTTGAAGG - Intronic
1108728368 13:53205331-53205353 ATAAAGCAGAGTAAAGAAGATGG - Intergenic
1108732148 13:53246327-53246349 GTGAAGAAGAGGAGAGAGAAAGG - Intergenic
1109092472 13:58065943-58065965 TTGAAGGAGAGCAATGAAGTTGG - Intergenic
1109157555 13:58929588-58929610 TAAAATAAGAGGAGAGAAGAAGG + Intergenic
1109181590 13:59220122-59220144 TAGAAGGAGAGAAAAAAAGAAGG + Intergenic
1109197887 13:59398754-59398776 TTGAAAAAAAGGAAAATAGAAGG - Intergenic
1109401218 13:61831195-61831217 CTGAATTAGAGGACAGAAGAAGG - Intergenic
1109430334 13:62224526-62224548 TTTATGAATAGGAAAGAACAAGG - Intergenic
1109596564 13:64563450-64563472 TTGAAGGAGATGAATGAAGTTGG - Intergenic
1109683350 13:65782793-65782815 TGGATACAGAGGAAAGAAGATGG - Intergenic
1109765362 13:66888571-66888593 TTTAAAAAGAGGAAAGAAAATGG + Intronic
1109830811 13:67785186-67785208 TTGATGAAAAGGAGACAAGAAGG + Intergenic
1109956785 13:69579617-69579639 TTAAAAAAAAGGGAAGAAGAAGG - Intergenic
1110041294 13:70762403-70762425 GGGAAGAAGAAGGAAGAAGAGGG + Intergenic
1110081673 13:71321421-71321443 ATAAAGAAGGAGAAAGAAGATGG + Intergenic
1110311560 13:74056062-74056084 TGCCAGAAGAGGAAAGCAGAAGG + Intronic
1110398362 13:75059663-75059685 TTGAAGAAGACATAAGAAAATGG + Intergenic
1110428549 13:75397395-75397417 TGGAAGCAGAGGAAAAGAGAAGG + Intronic
1110431350 13:75427541-75427563 TAGAAAAAGAAAAAAGAAGATGG + Intronic
1110565514 13:76953891-76953913 GTGTAGCAGAGGAAAGAAGATGG + Intronic
1110592641 13:77282491-77282513 GTGAAGAGAAGGGAAGAAGATGG - Intronic
1110721147 13:78763568-78763590 TAGAGATAGAGGAAAGAAGACGG - Intergenic
1110776215 13:79411188-79411210 TTGAAAAAGAGCAAAGAAGAGGG - Intergenic
1110827007 13:79983082-79983104 TTGAAGGAGAGGAACAAAGTTGG - Intergenic
1110903821 13:80860637-80860659 TGGAAGAAAAGGGAAGGAGAAGG - Intergenic
1111171433 13:84531646-84531668 TTGATTAAGAAAAAAGAAGAGGG + Intergenic
1111547572 13:89762445-89762467 ATGATAAAGAGAAAAGAAGAAGG - Intergenic
1111689733 13:91548654-91548676 TTGAAGGAGAAGAACGAAGTTGG + Intronic
1112066479 13:95798590-95798612 GTGAGGAAGAGGAAACATGATGG - Intergenic
1112142500 13:96660911-96660933 TAGAAGAAGTGGGAAGAAGGTGG + Intronic
1112204039 13:97306424-97306446 TTGAAGAAGAGGAAAGAAGATGG - Intronic
1112246521 13:97740090-97740112 TTTTAGAAGAAGAGAGAAGAAGG + Intergenic
1112406807 13:99127917-99127939 TTGAAGGAGAGGAACAAAGTTGG + Intergenic
1112530297 13:100195250-100195272 AAGAAGATGAGGTAAGAAGAAGG - Intronic
1112597362 13:100820194-100820216 TTTAAGAAGGGGAAATAAAAGGG + Intergenic
1113258606 13:108534779-108534801 AAGAAGAAGAAGAAAGAAGGAGG - Intergenic
1113308710 13:109108504-109108526 TTGAAGTAGAGGAAAACAGATGG - Intronic
1114035988 14:18627698-18627720 TTTAAGAACAGGAAAGAAGCTGG - Intergenic
1114038133 14:18648848-18648870 AAGAAGATGAAGAAAGAAGAAGG - Intergenic
1114120480 14:19666188-19666210 AGGAAGAAGATGAAAGAAGAAGG + Intergenic
1114122651 14:19687328-19687350 TTTAAGAACAGGAAAGAAGCTGG + Intergenic
1114252619 14:20974234-20974256 TTGAAGAAGGGAAAAGAAATAGG - Intergenic
1114469807 14:22952508-22952530 TGGGAGAAGAGATAAGAAGAAGG - Intronic
1114492189 14:23109999-23110021 ATGAAGATGAGGAAGGAGGAAGG + Intergenic
1114798425 14:25743076-25743098 TAGAGGAAAAGGAAAGATGAAGG + Intergenic
1115018529 14:28646379-28646401 AAGAAGAAGAAGAAAGGAGAAGG + Intergenic
1115095398 14:29630085-29630107 GAGAAGAAGAAGAAAGGAGAAGG - Intronic
1115106328 14:29765862-29765884 TTAAAGAATAGGAAAGGAGTTGG + Intronic
1115167132 14:30461616-30461638 TTCATGAAAAGGGAAGAAGAGGG + Intergenic
1115217515 14:31027078-31027100 TTCCAGAAAAGGAAAGAAGAGGG - Intronic
1115271719 14:31560298-31560320 TAAAAGGAGAAGAAAGAAGAAGG - Intronic
1115494600 14:33990609-33990631 TTGGAGAAGATGGAAGAAAATGG - Intronic
1115617963 14:35114285-35114307 TTGTAGAAAAGGAAAAAATATGG - Intronic
1115659106 14:35474438-35474460 AGGAGGAAGAAGAAAGAAGAAGG - Intergenic
1115856649 14:37636858-37636880 TTGAAAAAGAAGAAAAAAGTGGG + Intronic
1116964194 14:50997765-50997787 TTGAAGAAGCTGAAAAATGAAGG - Intronic
1117175584 14:53142967-53142989 TGGAAGAATAGGCAGGAAGATGG + Intronic
1117229385 14:53700137-53700159 TTGAAGATCAAGAAAGAAAAGGG - Intergenic
1117232963 14:53741042-53741064 TTGAAGAAGAAGAAGGAGCAAGG - Intergenic
1117266679 14:54095540-54095562 TTAAAGAAGCTGAAAGAAGATGG - Intergenic
1117330609 14:54708239-54708261 TTGAAGGAGAGGATTGAAGGAGG + Intronic
1117412833 14:55466381-55466403 GAAAAGGAGAGGAAAGAAGAGGG - Intergenic
1117796449 14:59399032-59399054 CTGAAGAAAAGGGAGGAAGAGGG - Intergenic
1117820322 14:59642409-59642431 TAGAAGAGGAGAAAAGAAAATGG - Intronic
1117853460 14:60001608-60001630 CTAAAGAAAAGGAAAGAAAAGGG + Intronic
1117905894 14:60585748-60585770 TTCAAGAAGAAGTAAAAAGATGG - Intergenic
1118026981 14:61779378-61779400 CTGAAGAAGAGAAAAGATGCAGG - Intronic
1118054068 14:62060056-62060078 TTTAAGAAGAGCAAAGTAGGGGG - Intronic
1118530014 14:66693899-66693921 TTGAAGAATAAGAAAAAAGTTGG + Intronic
1118667720 14:68088471-68088493 AGGAAGAAGATGAAAAAAGAGGG - Intronic
1118865076 14:69696582-69696604 CTGAAGATGTGGAAAGAAGGAGG - Intronic
1118965278 14:70576968-70576990 GTGAAGAATAAGCAAGAAGAAGG + Intergenic
1119089620 14:71769426-71769448 TTGAAAAAGAAGAATGAAGTTGG + Intergenic
1119584641 14:75821886-75821908 TTGAAGAGGAGGTAAAGAGAAGG - Intronic
1119872302 14:78028153-78028175 TCTAAGAAAAGGAAAGGAGAGGG - Intergenic
1119925383 14:78488764-78488786 ATGAAGAAGAAGAAAGGGGAGGG + Intronic
1119977071 14:79037085-79037107 TCTGAGAAGAGGAAAGAGGAAGG + Intronic
1120143541 14:80955281-80955303 TTAAAGAGGAGGAAAGGAGGGGG + Intronic
1120621024 14:86764799-86764821 TTGAGAAAGAGGAAAGAAAATGG + Intergenic
1120719076 14:87870902-87870924 AAGAAGAAGAAGGAAGAAGAAGG - Intronic
1121067200 14:90979286-90979308 AGGAAGAAGTGGAAGGAAGAGGG + Intronic
1121476075 14:94204524-94204546 TTGAAAAAGAGGAATGAAGTAGG - Intronic
1121743000 14:96267150-96267172 CTGAAGTAGAGGGAAGAAGAAGG + Intronic
1121878621 14:97478741-97478763 ATGTAGAATAGGAAAGAAAAGGG + Intergenic
1122601099 14:102922468-102922490 AGGAAGAAGGGCAAAGAAGAAGG - Intergenic
1122667207 14:103339166-103339188 TTGCAGAAAAAGAAAGAAGAGGG + Exonic
1123408457 15:20038932-20038954 TTGGAGAACTTGAAAGAAGAGGG + Intergenic
1123517781 15:21045573-21045595 TTGGAGAACTTGAAAGAAGAGGG + Intergenic
1123792327 15:23734258-23734280 AAGAAAAAGAAGAAAGAAGAGGG + Intergenic
1123792337 15:23734330-23734352 AAGAAGGAGAAGAAAGAAGAAGG + Intergenic
1124376717 15:29133243-29133265 TTGGTAAAGAGGAGAGAAGATGG - Intronic
1124463363 15:29913732-29913754 TTGAGGGAGAGGAAGGGAGAGGG + Intronic
1124643450 15:31415930-31415952 TTGAACAAGAAAAAAAAAGAGGG + Intronic
1124907274 15:33882053-33882075 TTGAAGAAGAGGGAAGACAGTGG - Intronic
1125049735 15:35283047-35283069 AAGAAGAAGAAGGAAGAAGAAGG - Intronic
1125075887 15:35617804-35617826 TTGAAAAAGAGGACAGCTGAAGG + Intergenic
1125201938 15:37107705-37107727 TTGAAACAGAGGAAAGGACATGG + Intergenic
1125397102 15:39261025-39261047 GAGAAGGAGAGGAGAGAAGAAGG + Intergenic
1125542075 15:40475370-40475392 GTGAGGAAGAGGAGAGGAGAGGG + Intergenic
1125840711 15:42798852-42798874 TTGAAGAGGAGGAAAAGAGGAGG + Intronic
1125845561 15:42849879-42849901 TTGTAGAAGAGGGAAGAACTTGG - Intronic
1125904334 15:43376615-43376637 TGGAACAAGAGGTAAGAAGGAGG + Exonic
1126402001 15:48281540-48281562 CTGAAGGAGAAGAGAGAAGAGGG + Intronic
1126526343 15:49659188-49659210 GAAAAGAAAAGGAAAGAAGAGGG + Intergenic
1126590540 15:50335526-50335548 TTGAAGAACTGGGAAGAAAAGGG - Intronic
1126661885 15:51040398-51040420 TTGAAAAAGAAGAAAAAAGTTGG - Intergenic
1126962387 15:54011734-54011756 TAGAAGAGGAGGAGAAAAGATGG - Intergenic
1127044309 15:55010069-55010091 TTGAAGAAGAAGAGAAATGATGG - Intergenic
1127067839 15:55258771-55258793 TTTAATAAGAGGAAACTAGATGG - Intronic
1127150568 15:56070673-56070695 TTGAAGGAGAAGAACAAAGATGG + Intergenic
1127228216 15:56958230-56958252 TGCAGGAAGGGGAAAGAAGATGG - Intronic
1127295552 15:57605751-57605773 TTGCAGAAGGGAAAAGATGAGGG + Intronic
1127502152 15:59564059-59564081 TTGAAAAAGAAGAAAGTTGAAGG - Intergenic
1127909353 15:63403310-63403332 AAGCAGAAGAGGAAAGAAGGAGG - Intergenic
1128002824 15:64209710-64209732 ATGAAAAAGAGAAAAGAACAAGG + Intronic
1128095622 15:64952357-64952379 AAGAGGAAGAAGAAAGAAGAAGG - Intronic
1128095653 15:64952663-64952685 AGGAAGAAGAAGAAGGAAGAAGG - Intronic
1128095659 15:64952737-64952759 GAGGAGAAGAGGAAAGAAGGAGG - Intronic
1128095748 15:64953691-64953713 AAGGAGAAGAAGAAAGAAGAAGG - Intronic
1128095772 15:64954055-64954077 AAGAGGAAGAAGAAAGAAGAAGG - Intronic
1128095851 15:64954930-64954952 GAGAAGAAGAGACAAGAAGAAGG - Intronic
1128336739 15:66791378-66791400 TTCTTGAAGAGGAAAGATGAGGG + Intergenic
1128356220 15:66928867-66928889 TAAAGAAAGAGGAAAGAAGAGGG + Intergenic
1128548343 15:68582011-68582033 GTGGAGAAGAGGAAAGCAGATGG + Intronic
1128549354 15:68588138-68588160 GTGAGGAAGAGGAAAGGAGTGGG - Intronic
1128614959 15:69101779-69101801 TTGAGAAAGTGAAAAGAAGAGGG - Intergenic
1128617516 15:69121699-69121721 AGGAAGAAGAGGAAAAGAGAGGG - Intergenic
1128898919 15:71401464-71401486 TTGAGGAATAGGAAAGATTAGGG - Intronic
1128941371 15:71790486-71790508 ATGAAGAACAGGCAAGAGGAAGG + Intergenic
1129314433 15:74732664-74732686 GTGAAGAAGAAGGAAAAAGAGGG - Intergenic
1129573059 15:76710788-76710810 TTGAAAAAGAACAAAGAAGTTGG + Intronic
1130171781 15:81522702-81522724 AGGAAGAAGGGGAAAGGAGAAGG + Intergenic
1130216339 15:81973855-81973877 GGGAAGAAGAGGAAGAAAGACGG + Intergenic
1130349565 15:83079112-83079134 TTCAAGAAGAGGATAAAAAAGGG + Intergenic
1130646619 15:85733556-85733578 TTGAAGAAGACCAAAGCAAAGGG - Intronic
1130696550 15:86137337-86137359 TTGAAAAATAGGAAAGAAGTTGG - Intergenic
1130847689 15:87762511-87762533 TTGGTGAAGATGAAAGGAGATGG + Intergenic
1131139816 15:89968077-89968099 ATGATGATGAAGAAAGAAGAGGG + Intergenic
1131218852 15:90563880-90563902 TTGAAAAAAAGGAAGGAAGGCGG - Intronic
1131302456 15:91211438-91211460 AGGAAGAAGATGGAAGAAGAAGG - Intronic
1131354738 15:91734911-91734933 GAGAAGAAGAGGAAGAAAGAGGG + Intergenic
1131494534 15:92894490-92894512 GAGAAGTAGAGGAAAGGAGATGG + Intronic
1131919310 15:97305936-97305958 TTCAAGAAGACAGAAGAAGATGG - Intergenic
1131937771 15:97525742-97525764 ATGGAAAAAAGGAAAGAAGAAGG + Intergenic
1131955463 15:97730533-97730555 CTGAAGGAGAAGCAAGAAGAAGG + Intergenic
1132127154 15:99237873-99237895 TTGAAGAGGAGGAATGGGGAGGG - Intronic
1132412885 15:101598243-101598265 TAGAACATCAGGAAAGAAGAAGG - Intergenic
1132628884 16:906744-906766 TTGAAGAAGAATAAAGATGCAGG - Intronic
1132770332 16:1558665-1558687 TTAAAGAAGAGGCAAGCAGTTGG - Intronic
1133172755 16:3992069-3992091 TTAAAGAAAAGAAAAGAAAAAGG + Intronic
1133626563 16:7575443-7575465 TTTAAGAAGAAAAAGGAAGAGGG + Intronic
1133778057 16:8913353-8913375 CTCAAAAAGAGGAGAGAAGAGGG + Intronic
1133883686 16:9806785-9806807 GAGAAAAAGAGGATAGAAGAAGG + Intronic
1134125658 16:11614266-11614288 AGAAAGAAGAGGAAAGAAGAAGG - Intronic
1134297570 16:12960772-12960794 TTGGAGAGGAGGGAAGAGGACGG - Intronic
1134324287 16:13192883-13192905 GAGAAGAAGAAGAAAGAAGGAGG + Intronic
1134330670 16:13248353-13248375 TTGGAGAAGGGGGAAGGAGAAGG - Intergenic
1134430376 16:14198947-14198969 TTGATGAAGAGCAAAAGAGAGGG - Intronic
1134555689 16:15162068-15162090 CTGAAAAAGAAAAAAGAAGAAGG - Intergenic
1134904840 16:17971506-17971528 AAGGGGAAGAGGAAAGAAGATGG + Intergenic
1134916271 16:18073779-18073801 CTGAAAAAGAAAAAAGAAGAAGG - Intergenic
1135156642 16:20058558-20058580 TCGCAGAAGAGGGAAGAAAAAGG - Intronic
1135232054 16:20717812-20717834 AAGAAGAAGAGGAAGGAAGAAGG + Intronic
1135504181 16:23021954-23021976 TTGAGGAAGAGGGAAGCACAGGG - Intergenic
1135751438 16:25061772-25061794 TTGCATAAGGGGAAAGAAAAAGG + Intergenic
1135866043 16:26102965-26102987 GTGCAGAAGTGGAAAGAACATGG + Intronic
1135942427 16:26834217-26834239 GTGAAGAAGAAGGAAGAGGAGGG + Intergenic
1136491884 16:30613936-30613958 AGGAAGGAGAAGAAAGAAGAAGG + Intronic
1136539119 16:30918826-30918848 GAGAAGAAGAAGAAAGAAGAAGG - Intergenic
1136595888 16:31249639-31249661 AGGAAGAAGAGGAAAGCACATGG - Intergenic
1137374556 16:47941598-47941620 TTGCAGAAGAGGAAGGAGTAGGG + Intergenic
1137395592 16:48114500-48114522 TAGCAGGAGAGTAAAGAAGACGG + Intronic
1137483408 16:48871332-48871354 CTGGAGAAGAGGAAAGAGGAAGG + Intergenic
1137556656 16:49474564-49474586 GGGAAGAAGAGGCAAGAAGTTGG - Intergenic
1137958305 16:52855063-52855085 TTTAAGCAAAGGCAAGAAGATGG - Intergenic
1138938394 16:61759327-61759349 TTTAAAAAGAAGAAAGAAGGAGG + Intronic
1139044515 16:63040400-63040422 AAGAAGGACAGGAAAGAAGAAGG + Intergenic
1139316409 16:66073730-66073752 TTGAGGGAGTGGAAAAAAGAAGG + Intergenic
1139327840 16:66165769-66165791 TTGGAGAGGAGGAAAAAAGAAGG + Intergenic
1140121676 16:72089014-72089036 TTGAAGAAAAAGACAGTAGATGG + Exonic
1140199781 16:72885751-72885773 GAGGAGAAGAGGAAAGGAGAAGG + Intronic
1140280261 16:73547377-73547399 TTGAACAAAAGGAATGAAGTAGG - Intergenic
1140447474 16:75042670-75042692 TTGAAAAAGAGGAACAAAAATGG - Intronic
1140561234 16:75984504-75984526 TTGAAAATGAGGATAGAAGAAGG - Intergenic
1140609612 16:76582216-76582238 TTGAAGAAGAGCAAGGTAGGAGG - Intronic
1140673841 16:77306554-77306576 TTGAAGAAGAAGAAAAAAAGAGG - Intronic
1140727000 16:77822529-77822551 TTGGAGGAGGGGAGAGAAGAAGG + Intronic
1141068813 16:80934862-80934884 TTGGAGATGGGGAAAGGAGATGG + Intergenic
1141089333 16:81119456-81119478 AGAAAGAAGAGGAAAAAAGAAGG - Intergenic
1141371727 16:83493231-83493253 CTGAAGAAGCAGAAAGAAGTTGG + Intronic
1141372406 16:83500367-83500389 AAGAAGAAGAAGAAAGAAGAAGG - Intronic
1141514600 16:84535224-84535246 AAGAAGAAAAGAAAAGAAGAAGG - Intronic
1141527101 16:84618430-84618452 GGGAAGAAGAGGAAGGAGGAGGG - Intergenic
1141766611 16:86063517-86063539 GTGAAGGAGAGGGAAGGAGAGGG + Intergenic
1141766637 16:86063607-86063629 GTGAAGGAGAGGGAAGGAGAGGG + Intergenic
1142379645 16:89724010-89724032 CTGAGGAAGAGGGAAGAATAGGG + Intronic
1142786982 17:2232060-2232082 TTGAAAAAGAGAGAACAAGAGGG + Intronic
1142832162 17:2557363-2557385 AGGAGGAGGAGGAAAGAAGAAGG + Intergenic
1142897940 17:2994312-2994334 TTTAAGAAAATGAAATAAGATGG - Intronic
1143179532 17:4975441-4975463 AAGAAGAAATGGAAAGAAGAGGG + Intronic
1143395407 17:6590978-6591000 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1143395409 17:6590998-6591020 AGGAAGAAGAAGGAAGAAGAAGG + Intronic
1143398233 17:6620109-6620131 TTACAGAAGAGGAAATAATATGG + Intronic
1143656944 17:8300443-8300465 AGGAAGAAGAAGAAAGAAGAAGG - Intergenic
1143737350 17:8922118-8922140 CTGGAGAATAGGAAAGAAGGAGG + Intronic
1143794681 17:9327172-9327194 AAGAAGAAGAAGGAAGAAGAAGG + Intronic
1144171536 17:12664126-12664148 ATGTAGAAGAGGGAAGCAGAAGG + Intergenic
1144247972 17:13386556-13386578 TTTAGGAAGGGGAAAGAGGAGGG - Intergenic
1144255218 17:13461038-13461060 TTAAAGAAGAGGACAGAAGTTGG + Intergenic
1144350567 17:14391501-14391523 AAGAAGCAAAGGAAAGAAGATGG + Intergenic
1144389169 17:14777776-14777798 TGGAAGGAAAGGAATGAAGAAGG + Intergenic
1144393797 17:14822934-14822956 TTGAAGAAAAGGAACAAAGCTGG + Intergenic
1145108581 17:20141369-20141391 TTGAAGAAGAGGAGATAAAGGGG - Intronic
1145247858 17:21281399-21281421 TAGAGGAAGAAGAAAGAGGAAGG + Intergenic
1145262360 17:21361970-21361992 TGGTAGAAGAAGAAAGAGGAGGG - Intergenic
1145387184 17:22422958-22422980 TTAAAAAAGAGAAAAGAAAAAGG + Intergenic
1145402865 17:22557020-22557042 TTGCAACAGAGGAAAGAATATGG + Intergenic
1145838094 17:27970037-27970059 TTCAACCAGGGGAAAGAAGACGG - Intergenic
1145920709 17:28607257-28607279 TTAAAGAAAAGGAAAGGGGAAGG + Intronic
1146010570 17:29191236-29191258 CTGAAGGAGAGGAAGGAGGAAGG - Intergenic
1146208739 17:30925541-30925563 AAGAAGAAGAAGAAGGAAGAAGG - Intronic
1146318131 17:31825201-31825223 TTGGAGAAGAGAAAAGGAGGGGG - Intergenic
1146402200 17:32508702-32508724 TTTCAGAAGAGGAAATGAGAAGG + Intronic
1146520056 17:33519339-33519361 TGGAAAGAGAGGAAAGGAGAAGG - Intronic
1146551625 17:33785205-33785227 GTGAAGATGAAGAAAGAAGATGG + Intronic
1146582921 17:34055528-34055550 TTGATTAAGAGGAAACAAGAAGG - Intronic
1146643505 17:34559626-34559648 CTGAAGAAGAGGCAAGAAAAAGG + Intergenic
1147169834 17:38611508-38611530 CAGAAGAAAAGGGAAGAAGAGGG + Intergenic
1147186386 17:38715589-38715611 CTGAAGGAGAGGAGAGAGGAAGG - Intronic
1147387480 17:40090835-40090857 CTGAATTAGAGAAAAGAAGAGGG - Intronic
1147700436 17:42390619-42390641 TGGAAGAATAGGATAGAATAAGG - Intergenic
1147776490 17:42905529-42905551 AAGAAGAAAAGGAAAGGAGAAGG + Intronic
1148180678 17:45602412-45602434 TGGAAGAAAGGGAAAGAAGGAGG - Intergenic
1148268225 17:46243512-46243534 TGGAAGAAAGGGAAAGAAGGAGG + Intergenic
1148703058 17:49602930-49602952 TTGAGGGATAGGAAAGAGGAAGG + Intronic
1148744697 17:49911761-49911783 CTGGAGAGGAGGGAAGAAGAGGG + Intergenic
1149206257 17:54252187-54252209 TTAAGGAAGAGGAAGGAAGAAGG + Intergenic
1149426153 17:56556841-56556863 TTGCAGAATAGGAGAGAATAAGG - Intergenic
1149689170 17:58559514-58559536 TTGGTGAAGAGAAAAGAAAAAGG - Exonic
1149797906 17:59538419-59538441 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1150179124 17:63096428-63096450 TTGAAGAAATGGAGAGAACATGG + Intronic
1150206913 17:63416067-63416089 TTGAAGAAGGGCTAAGGAGAGGG + Intronic
1150499721 17:65638896-65638918 TTTAGGAAGAGGAAAAAAAAAGG - Intronic
1150538037 17:66065068-66065090 ATGAATAAGAGAAAAGGAGAAGG - Intronic
1150591474 17:66566316-66566338 GTCCAGAAGTGGAAAGAAGATGG + Intronic
1150721829 17:67620015-67620037 TTGAAGCAGAGGAGAGGAAAAGG - Intronic
1150815559 17:68389605-68389627 CTGAAGAAGAGGAAGGGACAGGG - Intronic
1150844787 17:68644499-68644521 TTGTTGAAGAGGAAACTAGATGG - Intergenic
1150977233 17:70102184-70102206 GTGAACAAGAAGAAAGAAGAAGG - Intronic
1151029742 17:70722662-70722684 ATGAAGAAGAGAGAAGCAGAGGG + Intergenic
1151057918 17:71055435-71055457 TTAGAGAAGAGAAAGGAAGAAGG - Intergenic
1151116990 17:71747553-71747575 ATGAAAAAGAGAAAGGAAGAAGG + Intergenic
1151659182 17:75509634-75509656 TTGAGGCAGTAGAAAGAAGAGGG + Intronic
1151889521 17:76943895-76943917 GAGAAGAAGAGGTGAGAAGAGGG + Intronic
1152155732 17:78631677-78631699 GGGGAGAAGAGGAGAGAAGAGGG + Intergenic
1152155742 17:78631707-78631729 GGGGAGAAGAGGAGAGAAGAGGG + Intergenic
1152266150 17:79296047-79296069 GTCAAGAAGGGGATAGAAGAGGG + Intronic
1152598459 17:81249535-81249557 AGGAAGAGGAGGAAAAAAGAGGG + Intronic
1152666179 17:81570936-81570958 TAAAAGAAGAGGAAAGAAGTGGG + Intronic
1153091598 18:1352336-1352358 TTGAAGCACAGGAAGGAAAAGGG + Intergenic
1153100639 18:1465160-1465182 GAGAAGAAGAAGAAAGGAGAAGG - Intergenic
1153135028 18:1907063-1907085 AAGAAGAAAGGGAAAGAAGAAGG - Intergenic
1153177051 18:2387820-2387842 ATGAAGAAGCAGAAAAAAGAAGG + Intergenic
1153496022 18:5700441-5700463 CTGAAGAAGCTGAAAGGAGATGG + Intergenic
1153641941 18:7165093-7165115 GTGAGGAAGAGGGAAGCAGAAGG - Intergenic
1153705357 18:7739563-7739585 TTGAAGAATGGGAAAGCAAAAGG - Intronic
1153896973 18:9572429-9572451 TCTGAGAAGAGGAAAGAATATGG + Intronic
1154963776 18:21336237-21336259 TTAAGTAAGAGGGAAGAAGAGGG - Intronic
1155353083 18:24925500-24925522 TTAAAGAATTGAAAAGAAGAAGG + Intergenic
1155486519 18:26349258-26349280 TTTCGGAAGGGGAAAGAAGAAGG - Intronic
1155535036 18:26808282-26808304 TGGAAGAAGGGGTAAAAAGAAGG - Intergenic
1155662564 18:28268075-28268097 TCAAAAAAGAGGAAAGAAGCAGG - Intergenic
1155777596 18:29787354-29787376 AGGAAGAGGAGGAAAGAAGGAGG - Intergenic
1155996132 18:32333177-32333199 ATTAAGAGGAGGGAAGAAGAGGG + Intronic
1156091442 18:33476535-33476557 TTAAAGAAAAAGAAAGAAGTTGG + Intergenic
1156113254 18:33754137-33754159 ATGAAGAAGAAGAAAGAAACTGG - Intergenic
1156403741 18:36764195-36764217 AGAAAGAAGAGGAGAGAAGAAGG + Intronic
1156491349 18:37498319-37498341 GGGAAGAAGAGGGAAGGAGAGGG - Intronic
1156514355 18:37667682-37667704 TAACAGGAGAGGAAAGAAGAGGG - Intergenic
1156521601 18:37726424-37726446 TAGAAGAGGAGGAAAGAATGAGG + Intergenic
1156569055 18:38232050-38232072 TTGATGAAGAACAAAGTAGAAGG - Intergenic
1156768652 18:40690962-40690984 TTGAAGAACAAACAAGAAGATGG - Intergenic
1157006925 18:43594289-43594311 TAGAAAAAGAGGAAGGAAAATGG - Intergenic
1157214684 18:45773115-45773137 AAGAAGAAGAAGGAAGAAGAAGG - Intergenic
1157229898 18:45906022-45906044 ATTAAGAAGAGGACTGAAGATGG - Intronic
1157294366 18:46431947-46431969 TGGAAGAAAAAGAAAGCAGATGG - Intronic
1157715525 18:49883677-49883699 TTGAAGAAGATGAACAAAGCTGG + Intronic
1157768670 18:50325161-50325183 AAGAAGAAGAAGGAAGAAGAAGG - Intergenic
1158092308 18:53728414-53728436 TTGCTGAAGAAGAAGGAAGAGGG + Intergenic
1158191577 18:54834535-54834557 AGGAAGAAAAGGAAAAAAGAAGG - Intronic
1158377455 18:56887084-56887106 TAGAAAAAGAGGAAAGAATTAGG + Intronic
1158603516 18:58875148-58875170 TTGAAAAAGAGAAAAAAAGGGGG - Intronic
1158731068 18:60022962-60022984 TTTAAGAAGAAGAAGCAAGAAGG + Intergenic
1158951520 18:62499585-62499607 TAGATAAAGAGGAAGGAAGAAGG - Intergenic
1159746314 18:72240237-72240259 TTGAAGAAGATGAATGAAGTTGG - Intergenic
1159874027 18:73790351-73790373 GTAAAAAAGAAGAAAGAAGATGG + Intergenic
1159932722 18:74331234-74331256 TGAAAGAAGAGGCAAGAAGTGGG - Intronic
1160448687 18:78947160-78947182 GGGAAGAAGAGGACAGAGGAAGG + Intergenic
1160487895 18:79310090-79310112 GTGGAGAAGAGGCAGGAAGAAGG + Intronic
1160561322 18:79758345-79758367 CTGAAGGAGAAGAAAGAAGCTGG - Intergenic
1161166289 19:2789574-2789596 TGGAAGAAGCAGACAGAAGAAGG + Intronic
1161599124 19:5170082-5170104 TAAAAGAAGAAGGAAGAAGAAGG + Intronic
1161899614 19:7108801-7108823 TTGAAAAATAGCAAACAAGAAGG - Intergenic
1161905842 19:7155916-7155938 AAGAAGAAAAAGAAAGAAGAAGG + Intronic
1162203453 19:9038075-9038097 CTGAGGATGAGGGAAGAAGATGG - Intergenic
1162322919 19:9980361-9980383 TTTAAGAAAAGAAAAAAAGAAGG - Intronic
1162576293 19:11500943-11500965 TTGGAGAAGTGGACAGGAGAGGG - Intronic
1162872667 19:13598254-13598276 TTGAGGAAAAGGAAAGTAAAGGG + Intronic
1163050983 19:14683339-14683361 TAGAAGAAGAGAACTGAAGAAGG + Intronic
1163061267 19:14763904-14763926 AGGAAGAGGAGGAAAGAGGATGG - Intronic
1163105766 19:15122369-15122391 GAGGAGAAGAGGAAGGAAGAGGG + Intronic
1163141087 19:15349177-15349199 TTGAAAAAGAGGAACAAAGTCGG + Intergenic
1163387239 19:17007372-17007394 AGGAAGAAGAAGAAAGAAGAAGG + Intronic
1163387253 19:17007429-17007451 AGGAGGAGGAGGAAAGAAGAAGG + Intronic
1163884648 19:19955107-19955129 AAGGAGAAGGGGAAAGAAGAAGG + Intergenic
1164292322 19:23879639-23879661 AAGAAGAAAAGGAAAGGAGAAGG + Intergenic
1164324378 19:24179174-24179196 TAGAGGAAGAGGAAAAAAGAAGG + Intergenic
1164730101 19:30497062-30497084 TTTAAGGAGAGCAAAGTAGAGGG - Intronic
1164786902 19:30940081-30940103 TTGAAGAAGAGACAAAAAAATGG + Intergenic
1166038779 19:40190030-40190052 GAGAAGAAGAGGAAATAAGAGGG - Intergenic
1166079253 19:40433725-40433747 TTGAAGAAAACAAAATAAGACGG + Intergenic
1166266832 19:41689662-41689684 CTGAGGAGGAGGAAAGGAGAGGG - Intronic
1166430889 19:42726833-42726855 TTGAAGAGGAAGAATGAAGCTGG + Intronic
1166443905 19:42842168-42842190 TTGAAGAGGAAGAATGAAGCTGG + Intronic
1166451347 19:42904836-42904858 TTGAAGAGGAAGAATGAAGCTGG + Intronic
1166463587 19:43012832-43012854 TTGAAGAGGAAGAATGAAGCTGG + Intronic
1166480873 19:43172927-43172949 TTGAAGAGGAAGAATGAAGCTGG + Intronic
1166490455 19:43256049-43256071 TTGAAGAGGAAGAATGAAGCTGG + Intronic
1166657709 19:44624240-44624262 GAGAAGAAGAAGGAAGAAGAAGG - Intronic
1166886632 19:45965223-45965245 TTGAAGAAGCAGAGAGAGGACGG - Intronic
1166920465 19:46225994-46226016 TAAAAGAAGAAGAATGAAGAAGG + Intergenic
1167073696 19:47235999-47236021 AGGAAGAAGAAAAAAGAAGAAGG - Intergenic
1167129551 19:47574986-47575008 AGGAAACAGAGGAAAGAAGAGGG + Intergenic
1167153948 19:47726672-47726694 TTAAAAAAGAAGGAAGAAGAGGG - Intronic
1167161107 19:47767686-47767708 CAGAAGAAAAGGAAAGAAAAAGG + Intergenic
1167390899 19:49194252-49194274 TCAAAGAAGAAGAAAGGAGAAGG - Intronic
1167464050 19:49640876-49640898 TTGAAGGAGAAGGAAGCAGAGGG + Intergenic
1167527690 19:49995139-49995161 AGGAAGAAGAGGAAAGAGGCCGG + Intronic
1168024234 19:53632171-53632193 GTGAAGAAGTGGAAAGCAGCTGG + Intronic
1168135930 19:54351962-54351984 TTGTAGTAGGGGAAAGAAAATGG - Exonic
925429194 2:3776352-3776374 ATAAAGAAGAGGGGAGAAGATGG - Intronic
925852963 2:8101040-8101062 TTGAAGAAGCAGAAAGAGCAAGG - Intergenic
925882367 2:8363505-8363527 ATGGAGAAGAGGAAAACAGAAGG + Intergenic
926039954 2:9665077-9665099 TTGAATAGGCAGAAAGAAGAGGG - Intergenic
926058189 2:9788859-9788881 CTGAAGAAGAGTGAAGATGAAGG + Intergenic
926417660 2:12665651-12665673 CTGAAGTAGAGGAAGGAAGGTGG - Intergenic
926477542 2:13344664-13344686 TTGAAAAAGAAGAATGAAGTTGG + Intergenic
926534359 2:14092531-14092553 TGGAAGAAGAAGAAAAAAGAAGG + Intergenic
926946219 2:18190236-18190258 TTGGAGCAGAATAAAGAAGATGG + Intronic
927107678 2:19841953-19841975 GAGAAGAAGAGGAAAAAGGAGGG + Intergenic
927229403 2:20806158-20806180 TTGAAAAAGAGGTAATAAGATGG + Intronic
927332719 2:21884964-21884986 TTGAGGTTGAGGAAAGAAGAGGG - Intergenic
927332844 2:21886276-21886298 CTGAAGGTGAGGAAAGAAAATGG - Intergenic
927605001 2:24479072-24479094 TTAAAGAAGGGGAAAAAAAAAGG - Intergenic
927815500 2:26212873-26212895 TTGAAGATCAGGAGAGAAGCCGG - Intronic
928226706 2:29455518-29455540 TAGAAGCAGTGAAAAGAAGACGG - Intronic
928639334 2:33281396-33281418 TGGAAGAAGAAGAGAGCAGAAGG + Intronic
929298646 2:40276192-40276214 TTGTAACAGGGGAAAGAAGAAGG - Intronic
929371550 2:41230158-41230180 TTGAGGAAAAGGAAAAAAGCTGG - Intergenic
929466645 2:42150761-42150783 TTCAAGTCGATGAAAGAAGAAGG + Intergenic
929733861 2:44524566-44524588 ATGAAGATGAGGGAAGAGGAAGG - Intronic
929897034 2:45969580-45969602 GTGGAGAAGGGGAGAGAAGAGGG - Intronic
930102870 2:47616623-47616645 TGGAAGAAGAGTAAAAGAGAGGG + Intergenic
930326107 2:49920603-49920625 TTGAAAAGCAGGAAGGAAGAGGG - Exonic
930511389 2:52349727-52349749 GTGGAGGAGAGGAAGGAAGAAGG - Intergenic
930946946 2:57085845-57085867 TGGAAGAAAAGGAAAGAAGAAGG + Intergenic
930974328 2:57437051-57437073 TTGAACAGGAGGAAAGAGTAAGG - Intergenic
931066580 2:58594536-58594558 GAGAAGAAGAGGAAAGAAAGAGG - Intergenic
931142836 2:59482549-59482571 ATGGAGAAGAGGAAAGATTATGG + Intergenic
931188036 2:59972556-59972578 TTGAAAAAGGGGAAAGAAAGTGG - Intergenic
931362562 2:61590443-61590465 AAGAGAAAGAGGAAAGAAGAAGG + Intergenic
931477377 2:62603017-62603039 AAGAAGAAGAAGAAAGAAGGAGG - Intergenic
931555362 2:63497482-63497504 TTGAAGTTAAGGAAAAAAGAAGG - Intronic
931600771 2:64000939-64000961 TTGAAGAGAAGGACAGAAGCTGG - Intronic
931791403 2:65667098-65667120 TTCATGAAGAAGAACGAAGAAGG + Intergenic
931839555 2:66134041-66134063 AGCAAGAAGACGAAAGAAGAAGG + Intergenic
932198186 2:69802388-69802410 TGAATGAAGAGGAAAGGAGAGGG + Intronic
932389172 2:71369613-71369635 TGGAAGAAGAGGAAATGAGAAGG - Intronic
932757773 2:74420752-74420774 AAGAAGAAGAAGAAAGAAAACGG - Intronic
932911207 2:75807897-75807919 TTGAAGAAGAGAAAGGAGGGTGG + Intergenic
932918925 2:75887571-75887593 TGGCAGCAGAGGAAAGAGGAGGG - Intergenic
932938189 2:76131030-76131052 ATGAACAAGATGAGAGAAGATGG - Intergenic
933134044 2:78709409-78709431 TTGAAAAAGAGAAAAGTTGAAGG + Intergenic
933233056 2:79831034-79831056 ATTGAGAAGAGGAAAAAAGAGGG - Intronic
933342854 2:81044621-81044643 AAGAAGAAAAGGAAAGGAGAAGG + Intergenic
933569377 2:83991601-83991623 TTGAAGAAAGAGAAAAAAGAGGG - Intergenic
933573741 2:84043381-84043403 GTGAAGAAGAAAGAAGAAGAAGG + Intergenic
933656712 2:84894531-84894553 TTGAAGCAGAAGAAGGAAGTGGG - Intronic
933798485 2:85940885-85940907 TGAAAGAAAAGGAAAGAAGATGG - Intergenic
933805602 2:85996500-85996522 CTGAAGAAGAGGAAGGAGGTGGG + Intergenic
933925192 2:87085594-87085616 GTGAAGAAGAAGAAGGAAGAAGG + Intergenic
934110428 2:88737069-88737091 CAGAATGAGAGGAAAGAAGAGGG - Intronic
934511323 2:94946685-94946707 GTGAAGAGGAGGAGAAAAGAGGG - Intergenic
934535313 2:95128556-95128578 AAGAAAAAGAAGAAAGAAGAAGG + Intronic
934716379 2:96547018-96547040 TTGGAGCAGAGGAAAGAAAAGGG + Intronic
935274253 2:101462704-101462726 ATGATGAAGTGGAAACAAGATGG + Intronic
935311901 2:101792627-101792649 AATAAGAAGAAGAAAGAAGAAGG - Intronic
935317973 2:101856080-101856102 AAGAAGAAGAGGAGAGGAGACGG + Exonic
935631576 2:105216630-105216652 TTGAAGAGGAGGAAAGTAAAAGG - Intergenic
935685272 2:105677539-105677561 TCCAAGGAGAGGAGAGAAGAAGG + Intergenic
935810103 2:106789316-106789338 TTGCAGAAGGGGAAAGAACGTGG + Intergenic
935849711 2:107205145-107205167 TTGAAGAAGAATACGGAAGAAGG + Intergenic
936623213 2:114121297-114121319 TTGAAGTAGAAGAAATAACAAGG + Intergenic
936711442 2:115136055-115136077 TTTAAGAAGTGGAAGGAACAGGG + Intronic
936731293 2:115384447-115384469 AAGAAGAAGAAGGAAGAAGAAGG + Intronic
936731294 2:115384457-115384479 AGGAAGAAGAAGGAAGAAGAAGG + Intronic
936954068 2:118006867-118006889 TGGAAGAAGTGGAAGGTAGATGG + Intronic
936977236 2:118232376-118232398 AAGGAGAAGAGGAAGGAAGAGGG - Intergenic
936986785 2:118319147-118319169 GAAAAGAAGGGGAAAGAAGAAGG - Intergenic
937005006 2:118503356-118503378 GGAAAGAAGAGGGAAGAAGAAGG + Intergenic
937087423 2:119180737-119180759 TTTAGGAAGAGGAAGGAACATGG - Intergenic
937327125 2:120996723-120996745 ACGAAGAAGAAGAAAGAAGAAGG - Intergenic
937436426 2:121885547-121885569 TTGGAGAGGAGGAAAGAGAAAGG - Intergenic
937791168 2:125963309-125963331 TTGAAGAAGAAAAAATAAGTAGG + Intergenic
937869229 2:126776019-126776041 ATGAAAAGAAGGAAAGAAGAAGG + Intergenic
938144399 2:128821710-128821732 TGGCAGCAGAGGAAAGGAGATGG + Intergenic
938274407 2:130005252-130005274 TTTAAGAAAAGGAAAGAAGCTGG + Intergenic
938440974 2:131332026-131332048 TTTAAGAAAAGGAAAGAAGCTGG - Intronic
938604809 2:132881524-132881546 AGGAAGAAGAGGAAATAAGGGGG - Intronic
938810387 2:134847246-134847268 GTGAAAAAGAGGCAAAAAGATGG + Intronic
938984371 2:136559790-136559812 TGCAGGAAGAGGAAAGCAGATGG - Intergenic
939112890 2:138029249-138029271 ATGAAGTAGAGGTAAAAAGAAGG - Intergenic
939264215 2:139850838-139850860 TGGCAGAAAAGGAAAGTAGAGGG - Intergenic
940261156 2:151780932-151780954 GGTAAGAAGAAGAAAGAAGAAGG + Intergenic
940265870 2:151836748-151836770 TTTAAAAAGTTGAAAGAAGATGG + Exonic
940481827 2:154242007-154242029 CTGAAAAAGAGAAAAGAAGAGGG - Intronic
940517523 2:154699166-154699188 ATGAAGAAGAGGAAGGCAGAAGG - Exonic
940548095 2:155115680-155115702 TGGAGGAAGAAGAAAGAACAAGG - Intergenic
940620245 2:156103392-156103414 TTGAAGAAGAGCAAAGTCAAAGG + Intergenic
940817583 2:158312814-158312836 GTGAAGAGGATGAAAGAGGATGG + Intronic
940881576 2:158952267-158952289 TTTAAGTAGAGGAAAGCAGCAGG - Intergenic
941293080 2:163700372-163700394 TTGAAGAAGAGAAAGAAGGAAGG + Intronic
941591659 2:167427871-167427893 TTGTGGAAGAGGGAAAAAGAAGG - Intergenic
941695590 2:168547848-168547870 TAGTAGAAGCGGAATGAAGATGG + Intronic
941723149 2:168833671-168833693 TTGGAGAAGTAGAAAGAAGTAGG - Intronic
941778220 2:169415682-169415704 CAGAAGAGGAGGAAAGCAGAAGG - Intergenic
941784286 2:169480585-169480607 TTTAAGAAGATGAAAGAGAAAGG + Intronic
941812223 2:169766608-169766630 TTGGGGAAGAGAAAAGCAGAAGG - Intronic
942087590 2:172457889-172457911 ATGAAGAAGCAGAAAGCAGATGG + Intronic
942090463 2:172484970-172484992 TTTATGAAGAGGACAGAAAAAGG + Intronic
942244834 2:173998360-173998382 TTGAAGGAGGTGAGAGAAGATGG - Intergenic
942507366 2:176657125-176657147 AGGAAGAAGAAGAAAGAAGTGGG + Intergenic
942967944 2:181919668-181919690 TTTAATAACAGGAAAGAATAAGG + Intronic
942990687 2:182197846-182197868 TTGAAAAAGATTAAAGAAGTTGG - Intronic
943084237 2:183293646-183293668 TGGTAGAAGAGGAAGAAAGAGGG + Intergenic
943696531 2:190941717-190941739 TTTGAGAAGGGGAAAGAAGAAGG + Intronic
943730302 2:191295713-191295735 TGGAAAAAGATGAGAGAAGAAGG + Intronic
944166235 2:196724572-196724594 TTGAAGATAAGGAAACAAGCAGG + Intronic
944280996 2:197897197-197897219 AAGAGGAAGAAGAAAGAAGAAGG - Intronic
944329464 2:198448059-198448081 GGGAAGAAGAGGAGAGAAAAAGG + Intronic
944415092 2:199471792-199471814 TTGTTGCAGAGCAAAGAAGATGG + Intergenic
944522965 2:200590081-200590103 TAGAAGAGGAGGAAAGAAAGGGG - Intronic
944709663 2:202324385-202324407 TTGAAGCAGAGGGATCAAGAAGG - Intergenic
944829188 2:203515088-203515110 TTGAAAAGTAGGAAAGTAGAGGG + Intronic
945103957 2:206290293-206290315 TTGAAAAAGAGGAACAAAGTTGG - Intronic
945335657 2:208589826-208589848 TTGGATAAGAGAAAAGAGGACGG + Intronic
945392235 2:209278199-209278221 TTGACCAAGAGGAGAGAAGAGGG - Intergenic
946123001 2:217532823-217532845 TTCAATAAGTGGAAAGAGGAGGG - Intronic
946263963 2:218522209-218522231 TTGAAGAAGGCCTAAGAAGATGG - Intronic
946471294 2:219963672-219963694 TTGCAGAAAAGGAAAGAGAAAGG - Intergenic
946528533 2:220546585-220546607 AAGGAGAAGAAGAAAGAAGAAGG - Intergenic
946573664 2:221051244-221051266 TTGGAGGAGAGGGAAGAAGAAGG + Intergenic
946602879 2:221371380-221371402 TTGAAGTTGAGGAAAGAAGATGG + Intergenic
946888132 2:224245378-224245400 TCTATGAAGAGGAAAGAAAAAGG + Intergenic
947208823 2:227686920-227686942 TAATAGAAGAGGAAAGAAAATGG + Exonic
947315056 2:228848174-228848196 TTCAAAAAGATGAAAAAAGATGG + Intergenic
947375628 2:229492214-229492236 TTAAAGATGAGGAAACCAGAAGG + Intronic
947474743 2:230433434-230433456 TTGAAAAAGAAGAAAAAAGTTGG - Intronic
947491495 2:230599289-230599311 TTGAGAAAGAAGAATGAAGATGG + Intergenic
948127211 2:235572968-235572990 AAGAAGAAGAAGAAAAAAGATGG - Intronic
948297722 2:236875342-236875364 TGGAAGGAAAGGAAAGGAGAGGG - Intergenic
948617010 2:239205662-239205684 AGGAAGAAGAAGAAAGAAGAAGG + Intronic
948970344 2:241420922-241420944 CTCACGAAGAGGAAAGAAAAGGG + Intronic
1168942689 20:1726932-1726954 TTGCTGAAGAGAAAAGAAGAGGG + Intergenic
1169043338 20:2515016-2515038 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1169045531 20:2531841-2531863 GTGAAGAAGAAGAAGGAAGAAGG + Intergenic
1169047474 20:2545673-2545695 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1169049848 20:2566693-2566715 TTGAAAAGGTAGAAAGAAGAAGG + Intronic
1169765567 20:9144645-9144667 AAGAAGAAGAAGAAAGAAGGAGG + Intronic
1169948716 20:11018074-11018096 ATGAAGAAGAGGAGAAAAAAAGG + Intergenic
1170479520 20:16752274-16752296 ATGAAGAAGAGAGCAGAAGAGGG + Intronic
1170967440 20:21087470-21087492 TTGAGGAAGGACAAAGAAGAAGG + Intergenic
1171332493 20:24352756-24352778 ATGAAGAAAAGCCAAGAAGAAGG - Intergenic
1171773758 20:29347294-29347316 TTGATGAAGATGAGTGAAGATGG - Intergenic
1171815770 20:29784843-29784865 TTGATGAAGATGAGTGAAGACGG - Intergenic
1171902596 20:30871194-30871216 TTGATGAAGATGAGTGAAGATGG + Intergenic
1172971280 20:38874678-38874700 TGGCAGAAGAGGAAACAGGAAGG + Intronic
1173025430 20:39303313-39303335 TTTAAGAGAAGGAAGGAAGAAGG - Intergenic
1173058962 20:39643746-39643768 TTCAAGAAAAGGAATGATGATGG + Intergenic
1173077993 20:39839312-39839334 TTATTGAAGAGGAAAGAAAAGGG + Intergenic
1173261007 20:41435808-41435830 TTGAAAAAGAAGAAAAAAGTGGG + Intronic
1173307399 20:41863358-41863380 TGGGTGCAGAGGAAAGAAGATGG - Intergenic
1173416043 20:42856825-42856847 TGTATAAAGAGGAAAGAAGAGGG + Intronic
1173465408 20:43276931-43276953 TTAGAGAAGAGGAAAGGAGGAGG - Intergenic
1173468724 20:43305676-43305698 TTGGAGAAGAGTAAGGAAGAGGG + Intergenic
1174011660 20:47454639-47454661 AAGAAGAAGAAGGAAGAAGAAGG - Intergenic
1174198426 20:48789893-48789915 TGGATAAGGAGGAAAGAAGAAGG + Intronic
1174970491 20:55269931-55269953 TTAAAGGAGAGTAAAAAAGAAGG - Intergenic
1174970542 20:55270433-55270455 GTGAACAAGAGAAAAGAAGCTGG - Intergenic
1175055245 20:56191978-56192000 TTGAAGAAGAGAGAAGAGAAAGG - Intergenic
1175130088 20:56782338-56782360 GGGAAGAAAAGGAAGGAAGAAGG + Intergenic
1175438637 20:58974000-58974022 AAGAAGAAGAAGGAAGAAGAAGG + Intergenic
1176893559 21:14348407-14348429 ATTGAGAAAAGGAAAGAAGACGG + Intergenic
1177095134 21:16823266-16823288 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1177189480 21:17834159-17834181 TTGAAGAAGGGTAAAGCAGAAGG - Intergenic
1177235758 21:18388056-18388078 TAGAAGAGGAGGATAGAAAAAGG - Intronic
1177449561 21:21247910-21247932 TTGAAGAGAAAGAAGGAAGAAGG - Intronic
1177791844 21:25730942-25730964 TAGAAGAAAAGGAATAAAGAGGG + Intronic
1177955088 21:27588352-27588374 TTGATGAAGACAAAAGAAAAAGG + Intergenic
1178005962 21:28219804-28219826 TTGGGGAAGAGGAATGAGGATGG - Intergenic
1178030067 21:28515389-28515411 TTGAAGAAAAGAAAAGGATAAGG - Intergenic
1178125968 21:29516120-29516142 TTGTAGAAGGGAAGAGAAGAAGG + Intronic
1178205515 21:30459836-30459858 GTGAAAAACAGGAAAGTAGATGG - Intergenic
1178643204 21:34363351-34363373 AGGAAGAAGAAGGAAGAAGAAGG - Intergenic
1178643205 21:34363361-34363383 AGGAAGAAGAAGGAAGAAGAAGG - Intergenic
1178643206 21:34363371-34363393 AGGAAGAAGAAGGAAGAAGAAGG - Intergenic
1179024846 21:37671392-37671414 TGGGAGAAGAGGCAAGAAGAGGG - Intronic
1179081847 21:38178699-38178721 AGAAAGAAGAAGAAAGAAGAAGG + Intronic
1179081848 21:38178722-38178744 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1179340521 21:40504160-40504182 GAAGAGAAGAGGAAAGAAGAGGG + Intronic
1179367112 21:40768864-40768886 TAGAACAAGAGGAAAAAACAAGG + Intronic
1179483242 21:41691893-41691915 CTGAAGAAGAGGATGGATGAGGG + Intergenic
1180232023 21:46432414-46432436 TTGAAGAGGAAGAACGAAGTTGG - Intronic
1180319221 22:11305410-11305432 TTGATGAAGATGAGTGAAGACGG - Intergenic
1180335986 22:11577162-11577184 TTGATGAAGATGAGTGAAGATGG + Intergenic
1180460113 22:15554752-15554774 TTTAAGAACAGGAAAGAAGCTGG - Intergenic
1180462259 22:15575889-15575911 AAGAAGATGAAGAAAGAAGAAGG - Intergenic
1180525454 22:16254901-16254923 AGGAAGAAAAGGAAAGAGGAAGG + Intergenic
1180861083 22:19083388-19083410 GTGAAGAAGAGGAATGAGGAGGG - Intronic
1181416356 22:22762257-22762279 CTGCAGGAGAGGAAAGGAGAGGG - Intronic
1181504208 22:23340468-23340490 AAGAAGAAAAGGAAAGAAGTGGG + Intergenic
1181655318 22:24293080-24293102 AAGAAGAAAAGGAAAGAAGTGGG + Intronic
1181709201 22:24670704-24670726 AAGAAGAAAAGGAAAGAAGTGGG + Intergenic
1181846498 22:25713686-25713708 TTGAATATGAGCAAAGAAAATGG - Intronic
1182109027 22:27709921-27709943 TTGTGGAAGAGCAAAGGAGACGG - Intergenic
1182311133 22:29408333-29408355 TTGAAGGAAGGCAAAGAAGAGGG - Intronic
1182457244 22:30459795-30459817 TTGCAGAAGAGGAAAAAGCAAGG - Exonic
1182505293 22:30777883-30777905 TTGGAGGAGAGGGAGGAAGAAGG + Intronic
1182755894 22:32678604-32678626 AGGAAGAAGAGGAAGAAAGAAGG - Intronic
1183400752 22:37602587-37602609 TTACAGAGGAGGAAAGTAGAGGG - Intergenic
1183680407 22:39325417-39325439 AGGAAGAAGAAGAAAGAAGAAGG + Intergenic
1183821935 22:40353303-40353325 AAGAAGAAGAAGAAAGGAGAAGG - Intronic
1183980262 22:41535528-41535550 ATCAAGAAGAGGAAGGAAGCTGG + Intronic
1183981848 22:41545246-41545268 CGGAAGAAGAAGAAAGAAGAAGG + Intergenic
1184185662 22:42863330-42863352 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1184345969 22:43913155-43913177 AAGAAGAAGAAGGAAGAAGAAGG - Intergenic
1184345971 22:43913229-43913251 AGGAAGAAGAAGGAAGAAGAAGG - Intergenic
1184345972 22:43913239-43913261 AAGAAGAAGAAGGAAGAAGAAGG - Intergenic
1184882832 22:47322159-47322181 TGGAAGAAAAGGAGATAAGATGG - Intergenic
1184952452 22:47853625-47853647 AGGAAGAAGAAGAAGGAAGAAGG + Intergenic
1184952454 22:47853645-47853667 AGGAAGAAGAAGGAAGAAGAAGG + Intergenic
1184989879 22:48160183-48160205 AAGAAGAAGAAGAAAGAAGAAGG + Intergenic
1185089395 22:48757297-48757319 AGGAGGAAGAGGAAAGAGGAGGG + Intronic
949143539 3:665871-665893 GTGAAGAAATGGAAAGAAGCTGG - Intergenic
949220888 3:1632704-1632726 TTGACCAAGAGAAGAGAAGAGGG - Intergenic
949372243 3:3347927-3347949 TTGAATCAGTGGAAAAAAGAAGG - Intergenic
949710881 3:6870001-6870023 AAAAAGAAGAGGAAAGGAGAAGG - Intronic
949828791 3:8191614-8191636 AAGAGGAAGAAGAAAGAAGAAGG - Intergenic
949828793 3:8191640-8191662 AAGAAGAAGAAGGAAGAAGAAGG - Intergenic
950245457 3:11412623-11412645 TTGAAGAAGAGGAGCAAAGCTGG - Intronic
950975271 3:17235695-17235717 TTCAGGGTGAGGAAAGAAGAGGG + Intronic
951170450 3:19535771-19535793 TTGGAGAGGGGGAAAGTAGAAGG - Intergenic
951208806 3:19951912-19951934 AAGAAAAAGATGAAAGAAGAAGG + Intronic
951287496 3:20832682-20832704 TTGAAGAAAGAGAAAGAAGTGGG - Intergenic
951431949 3:22618417-22618439 GTGAAGAAGAGGAAGAAAAAAGG + Intergenic
951481170 3:23163976-23163998 ATGAAGAGGAGGAAAGAAATTGG + Intergenic
951611480 3:24495621-24495643 TTGGAGAAGAGGAAAGAATGGGG + Intergenic
951615584 3:24539996-24540018 CTGAAGAAAAGGAGGGAAGAGGG - Intergenic
951629913 3:24708492-24708514 TCAAAGAAGAGGGAAGAAAAGGG + Intergenic
951964972 3:28371960-28371982 AGGAGGAGGAGGAAAGAAGAAGG - Intronic
952071183 3:29637920-29637942 TTGGCAAAGAGGAAAGAAGGTGG - Intronic
952344475 3:32471027-32471049 AAGAAGAAGAAGATAGAAGAAGG + Intronic
953201015 3:40778572-40778594 TTAAAGAAGGGGCAGGAAGATGG + Intergenic
953367169 3:42354750-42354772 GTGAAGAAGAAGAAAGGAGGAGG - Intergenic
953395091 3:42562708-42562730 TGGGAGAAGAGGAATGGAGATGG - Intronic
953633358 3:44639755-44639777 TTCAGGAAGAGGAAAGGACACGG + Intronic
954006644 3:47596596-47596618 AAGAAGAAGAAGAAAAAAGATGG + Intronic
954873704 3:53786884-53786906 TTCAAGAAACGGAAAGAACAAGG + Exonic
955114252 3:55981588-55981610 AGGAAGAAGAGGAAGGAGGAGGG + Intronic
955307444 3:57848500-57848522 AGGAAGAAGAAGAAAGAAGAAGG - Intronic
955461151 3:59184513-59184535 GTGAAAAAAAGGAAGGAAGAAGG + Intergenic
955871169 3:63440274-63440296 CTGAAGAGTAGGAAAGGAGAGGG + Intronic
955949827 3:64231897-64231919 CTGAAGTAAAGGAAAGAATATGG - Intronic
955994406 3:64664870-64664892 TTCAAGAAGAAGCAAGAAAATGG - Intronic
956109734 3:65858634-65858656 TTGGAGAAGAGGAAAGGAGGAGG + Intronic
956160413 3:66345570-66345592 TGGAAGAAAAGGAAAGAAAGTGG - Intronic
956674515 3:71721861-71721883 TTGAAGGACAGGAAAGAGCAGGG + Intronic
956965970 3:74460880-74460902 TTGAAGAAGAGAAGTGAATATGG + Intronic
957223109 3:77410480-77410502 AGGAGGAGGAGGAAAGAAGAGGG - Intronic
957320540 3:78624784-78624806 CTTATGAAGAGTAAAGAAGAGGG + Intronic
957337701 3:78853174-78853196 TTGAAGAGCAGGGGAGAAGAAGG + Intronic
957567097 3:81897904-81897926 TTCAAAAAGATGGAAGAAGAGGG + Intergenic
957828734 3:85487465-85487487 CTGAAGAAGAAGAAAGGAAAAGG + Intronic
958028895 3:88083051-88083073 AGGAAGAAGAGGGAGGAAGAGGG - Intronic
958079269 3:88724819-88724841 TTAAAGAAGTGCAAAGAATATGG - Intergenic
958475640 3:94577514-94577536 TTGAAGGAGAAGAACAAAGATGG + Intergenic
958854595 3:99369381-99369403 TGGAAAAAGAAGAAAGAATACGG + Intergenic
958899110 3:99864722-99864744 TTGAGGAATAGCAAAGAAGCTGG - Intronic
958926295 3:100161182-100161204 TGGGATTAGAGGAAAGAAGATGG + Intronic
959207094 3:103323234-103323256 TACCAGAAGAGGAAGGAAGAGGG - Intergenic
959237768 3:103746503-103746525 TTGGAGAAGAGGTATGTAGATGG - Intergenic
959341219 3:105134444-105134466 TTAAAGCAGAAGAAAGAAAAAGG + Intergenic
959483920 3:106906563-106906585 TATAAGAAGAGGAAGAAAGACGG - Intergenic
959821701 3:110742553-110742575 TTGAAAAAAAGGAAAGAATCAGG + Intergenic
960184603 3:114623494-114623516 ATGCAGAAGAATAAAGAAGAGGG + Intronic
960236436 3:115288264-115288286 TTCAAGAAAAGTTAAGAAGAGGG + Intergenic
960619900 3:119627659-119627681 CTGAAAAAGAGGAAAGAAGGAGG - Intronic
960664849 3:120098767-120098789 TTGAAGATGAAGAAAGAAGAGGG + Intergenic
960812444 3:121637491-121637513 TTGAAGAAGAAGGGAGAAAATGG - Intronic
960873634 3:122275548-122275570 TTGAAGATGGGGAAAGGAAAGGG - Intronic
960931944 3:122861079-122861101 TGGAAGAGGAAGAAAGAAGAAGG - Intronic
960981341 3:123229943-123229965 TTGAAAAAAAGCAAAGAACAAGG + Intronic
961076190 3:123984870-123984892 TTTAAGCAGATGAAAGAAGAAGG - Intronic
961225176 3:125237836-125237858 TTGAAAAAGAAGAATGAAGCAGG + Intronic
961348542 3:126282163-126282185 TTGAAAAAGAAGAATGAAGTTGG - Intergenic
961397473 3:126605937-126605959 AGGAAAAAGAGGAAAAAAGAGGG + Intronic
961874665 3:130013096-130013118 TTGTAGAAGAGGAACAAAGTTGG - Intergenic
962100240 3:132334212-132334234 TAGAAGAGGAGGAAAGAAACAGG + Intronic
962330088 3:134470895-134470917 TTGAATAAGAGCAAGGGAGAGGG + Intergenic
962453598 3:135544020-135544042 TTGAAGAAGAATAACAAAGATGG - Intergenic
962736867 3:138333211-138333233 TTAAAGATGAGGAAACAAGCCGG - Intergenic
963037702 3:141046937-141046959 GTGAAGGAGAGGCAAAAAGATGG + Intergenic
963088974 3:141464184-141464206 TAGAAGCAGAACAAAGAAGAAGG - Intergenic
963099079 3:141581308-141581330 TGGAAGAAGAAAAAAGAAAAAGG - Intronic
963295956 3:143546916-143546938 TAGAATAAGAGGAAAGAAATTGG - Intronic
963854802 3:150242478-150242500 TGGAAGAAGAGAAAAGAACTTGG + Intergenic
964927613 3:161977369-161977391 GTAAAGAAGAGGATAGAAAATGG + Intergenic
965017874 3:163182830-163182852 ATGAAGATGATGAAGGAAGAAGG - Intergenic
965126346 3:164634968-164634990 TTCAAGAAAAGGCAAGAAGAAGG - Intergenic
965298764 3:166983899-166983921 GATCAGAAGAGGAAAGAAGAGGG + Intergenic
965711734 3:171562693-171562715 AGGAAGAAGAAGGAAGAAGAAGG - Intergenic
965711735 3:171562703-171562725 AGGAAGAAGAAGGAAGAAGAAGG - Intergenic
965711736 3:171562713-171562735 AAGAAGAAGAAGGAAGAAGAAGG - Intergenic
965749148 3:171958536-171958558 TATAAGCAGAGCAAAGAAGAGGG + Intergenic
965783525 3:172313061-172313083 GAGAAAAAGGGGAAAGAAGAGGG - Intronic
965783851 3:172315983-172316005 AAAAAGAAGAAGAAAGAAGAAGG - Intronic
965853727 3:173063351-173063373 ATGCAAAAGTGGAAAGAAGAAGG + Intronic
966087147 3:176081603-176081625 AGGAAATAGAGGAAAGAAGACGG + Intergenic
966474887 3:180333115-180333137 CTGCAGAAGAGGAAAGGAAAAGG + Intergenic
966627699 3:182036487-182036509 GTGAAGAAAAGGAAAGGAAAGGG - Intergenic
966666135 3:182472993-182473015 TAGAAGAAGAAGACTGAAGAGGG - Intergenic
967301485 3:188018691-188018713 GAGAACAAGAGGAGAGAAGAGGG + Intergenic
967341334 3:188401755-188401777 TTGGGGAACAGGAAAGCAGATGG + Intronic
967494618 3:190128906-190128928 CTAAAGAAGAGAACAGAAGAGGG - Intergenic
967687248 3:192432075-192432097 TTGAAGAATGGGAATTAAGAGGG - Intronic
968009132 3:195261462-195261484 TTAAAGAAAAGAAAAGAAAAAGG + Intronic
968024394 3:195427093-195427115 TAAAAGAGGAGGATAGAAGAGGG + Intronic
968376544 4:47593-47615 AAGAAGAAGAAGAAAGAAGAAGG + Intergenic
968783466 4:2600725-2600747 TTGAAGAAGATGAAAACAGATGG - Intronic
969338530 4:6526538-6526560 TTGGTGAAAAGAAAAGAAGAGGG + Intronic
969656110 4:8499448-8499470 TTGAAGAAGAGGGAAGGCAAAGG - Intergenic
970041320 4:11800105-11800127 TTTCAAAGGAGGAAAGAAGAAGG - Intergenic
970368835 4:15387947-15387969 AGGGAGAAGAGGAGAGAAGATGG + Intronic
970512231 4:16792801-16792823 TTTAACAAGAGGAAGGAGGAAGG + Intronic
970618437 4:17790778-17790800 TTGAATAACAGGGAAGTAGAAGG + Intergenic
970726055 4:19046034-19046056 TTGAAGCAAAGGAGAAAAGAAGG + Intergenic
970814202 4:20134508-20134530 GAGAAGAAGAAGGAAGAAGAAGG + Intergenic
970916093 4:21337030-21337052 TTTAAGGAGAGGAAAGAGCATGG + Intronic
970973791 4:22019223-22019245 AAGGAGAAGAGGAAAGAAAATGG - Intergenic
970998800 4:22299083-22299105 TTCAAGAAGAGGGAAGAGCATGG - Intergenic
971577401 4:28293226-28293248 TTGAAGAAGCAGAAAGATGAAGG + Intergenic
971652263 4:29293432-29293454 TGGAAGAGGAAGGAAGAAGAAGG - Intergenic
971663381 4:29449955-29449977 AGGAAGAAAAGGAAAGAGGAGGG + Intergenic
971733772 4:30419237-30419259 TTGAAAAAGAATAAAGAAGAAGG + Intergenic
971979216 4:33732244-33732266 TTGAGGAAGAGGTATGTAGATGG - Intergenic
971981994 4:33763579-33763601 TGGAAGAAGATGAAATAAGCTGG + Intergenic
971988164 4:33854913-33854935 TGGAAGATGCGGACAGAAGAGGG + Intergenic
972119781 4:35685967-35685989 TTGAAGAAGAGGATGCAAAAAGG - Intergenic
972134964 4:35880954-35880976 TTGAAAAAAAGTAAAAAAGAAGG - Intergenic
972447131 4:39155334-39155356 TTGAAGAAAAAGAAAAAAGTTGG + Intergenic
972662433 4:41129297-41129319 CTGAAGATGAGGCAAGAAAATGG - Intronic
972818574 4:42672952-42672974 TTGAAGAAGCTGAAAGAACTTGG + Intergenic
973189740 4:47373244-47373266 TGGAAGAAGCAGAAAGAAAAAGG - Intronic
973241129 4:47956724-47956746 TGAAAGAAGAGGAAGGAAAAGGG + Intronic
973630070 4:52811949-52811971 TTTAAAATGAGGAGAGAAGAGGG + Intergenic
973754899 4:54064766-54064788 TAGAAGCAGAGGAAAGACGGTGG - Intronic
973807621 4:54540860-54540882 TTGACGAAAAGGAAGGAAGGAGG - Intergenic
973862447 4:55078724-55078746 TTGAAAAAAAGGACAGAACAAGG + Exonic
973926230 4:55740907-55740929 TTGAAGGAGAGGAAGGAATTAGG + Intergenic
973956319 4:56066891-56066913 GTCTAGAAGAGGAAAGAAGATGG + Intergenic
974068131 4:57099266-57099288 TTGAGGGAGAAGAAAAAAGAGGG - Intronic
975028214 4:69578510-69578532 GAGAAGAAGAAGAAAGAAGGAGG - Intergenic
975314290 4:72933505-72933527 TTGTGGTTGAGGAAAGAAGAGGG - Intergenic
975376819 4:73655629-73655651 TTGAAAAACAGGAACAAAGATGG + Intergenic
975410884 4:74048002-74048024 TTGAAGAGGAGTAACGAAAATGG + Intergenic
975524987 4:75339243-75339265 TGGAAGAAAAGGAGAGAGGAGGG - Intergenic
975641830 4:76508492-76508514 TTGAAAAAGAAGAAAGAAGTTGG - Intronic
975667305 4:76745073-76745095 TTAAAGGAGAGGAAAATAGAAGG - Intronic
975878934 4:78878699-78878721 TTGAGTAAGAAAAAAGAAGATGG - Intronic
975972375 4:80056116-80056138 AGGAAGCAGAGGAAAGAACATGG + Intronic
976112097 4:81686432-81686454 ATGAAGAAGTGAAAAAAAGATGG - Intronic
976211301 4:82673704-82673726 TTGAAGAAGAAGAACAAAGTTGG + Intronic
976267519 4:83198045-83198067 GTAAGGAAGAGGGAAGAAGACGG + Intergenic
976400708 4:84603449-84603471 TTGTAGAAGAGGAAAGAACATGG + Intronic
976423086 4:84868233-84868255 ATTAAGAAGAAGAAAGAAAAAGG - Intronic
976561911 4:86511614-86511636 AGGAGGAAGAGGAAAGAAGAAGG + Intronic
977106967 4:92898598-92898620 TTGCAGAAGAGGAGAGAAAAAGG + Intronic
977377988 4:96232947-96232969 TTGAAGAAGAAGAACAAAGTTGG + Intergenic
977680407 4:99792590-99792612 GTGAGGAAGAGGAAACAAGTAGG + Intergenic
977922564 4:102661544-102661566 TTGAAGAACATTGAAGAAGAAGG + Intronic
977966538 4:103156284-103156306 TTGAAAAAGAAGAACGAAGTTGG + Intronic
978125700 4:105132733-105132755 TTGTAGATGAGCAAAGAAAATGG - Intergenic
978264777 4:106810417-106810439 AGGAAGAAGAAGGAAGAAGAAGG - Intergenic
978268539 4:106858990-106859012 AAGAAGAAGAAGAAAGAAGGAGG + Intergenic
978303648 4:107297839-107297861 TTGTAGAAGAAGAACAAAGATGG + Intergenic
979131214 4:117047564-117047586 ATGAGGAAGAGGAAAAAAGGAGG - Intergenic
979490433 4:121320522-121320544 CTGAAGGGGAGGCAAGAAGATGG - Intergenic
979567585 4:122172903-122172925 ATGAAGAAGAGGAAGAAAGCTGG + Intronic
979644518 4:123053013-123053035 TGGAAGAAGATGAAATAAGCCGG - Intronic
979712994 4:123802847-123802869 GGGAAGAAGAGGAAGGAAGACGG - Intergenic
979757093 4:124354483-124354505 TTGAAGAAGAAGAAGAAAGTTGG - Intergenic
979978770 4:127228641-127228663 TTGAGGAAAGTGAAAGAAGACGG + Intergenic
980108477 4:128611379-128611401 TTGAAGAGGTGGAAAGAAATGGG - Intergenic
980142099 4:128931028-128931050 GAGAAGAAGAGGAAATGAGAAGG + Intronic
980201465 4:129660522-129660544 TTGAAGAAGAAGAAAGTTGGAGG - Intergenic
980279533 4:130701785-130701807 GTGAAGAGGAGCAAATAAGATGG + Intergenic
980431445 4:132703646-132703668 TTGAAAGAGAGGAAAAAATATGG + Intergenic
980460475 4:133104712-133104734 TTGAAGAAGAGGCAGAAAAAAGG - Intergenic
980948892 4:139351894-139351916 ATGAACAAGATGAAAGAAAATGG - Intronic
981010388 4:139919236-139919258 TTGAAGAAGGGGGAGGAAGGGGG + Intronic
981408858 4:144404122-144404144 TGGAAGGAAAGGAAAAAAGAGGG + Intergenic
981416012 4:144494352-144494374 TTGAAGCAGAGAGAAGAAAAGGG + Intergenic
981590651 4:146356596-146356618 AAGAAGTAGAGGAGAGAAGATGG - Intronic
982146457 4:152400001-152400023 CTGAAGGAGAGGAATGAAGCTGG + Intronic
982460201 4:155660448-155660470 TTGTAGAAAAGGAGGGAAGAAGG - Intergenic
982469377 4:155769055-155769077 TTGGAGAAGATGAAGGAAGAAGG - Intronic
982509826 4:156267575-156267597 TCTAAGAAGAGGAAATAACATGG - Intergenic
982632903 4:157854786-157854808 TTGAAGAAGAGCAGAGAAAAAGG + Intergenic
982904760 4:161053847-161053869 TTTAGGAAGAAGAAAGAAGCGGG + Intergenic
983251028 4:165346734-165346756 GAGAAGACAAGGAAAGAAGAGGG + Intergenic
983310906 4:166060004-166060026 TAGAAGAAAAGAAAAGAAAAAGG - Intronic
983339367 4:166438613-166438635 CTAGAGGAGAGGAAAGAAGAAGG - Intergenic
983408539 4:167365576-167365598 TTGAAGAAGAGTGAAAAAGACGG + Intergenic
983426715 4:167593458-167593480 AAGAAGAAGAAGAAAGAAGAAGG + Intergenic
983443855 4:167823918-167823940 TTGCAGCAGTGGAAACAAGATGG - Intergenic
984036298 4:174672377-174672399 TTGGAGAGGAAGAAAGAAAAAGG - Intronic
984085502 4:175305811-175305833 TAGAAGAAATGGAAAGAAGTAGG + Intergenic
984114383 4:175661495-175661517 TTGAAAAGGAGCAATGAAGAAGG + Intronic
984632497 4:182075577-182075599 TTGAAGAAGACAGAAGAAGTTGG - Intergenic
984669872 4:182470519-182470541 TTCAAAATGAGGAAAGGAGAGGG + Intronic
984720151 4:182963986-182964008 TTAAAGAAGCTGAGAGAAGAAGG - Intergenic
984791318 4:183617390-183617412 TTGAAAAAAAAGAAAGAGGAAGG - Intergenic
984863607 4:184261463-184261485 CTGCAGAAGAGGAAAGGAGCTGG - Intergenic
984895395 4:184534832-184534854 TTAATGTAGAGGAAAGATGAAGG - Intergenic
984912832 4:184690110-184690132 TTACAGAAAAGGAAATAAGATGG - Intronic
985123586 4:186668297-186668319 TTGAATCAGAGGCAAGACGAAGG + Intronic
985128418 4:186718183-186718205 TTTAAGAGGAGGAGGGAAGATGG - Intronic
985138928 4:186819247-186819269 TTGAAGGAGAGGAGAGAGAAAGG - Intergenic
985147788 4:186912061-186912083 TTGCAGAAGAGAAAAAAGGAAGG - Intergenic
985192061 4:187385084-187385106 TTTAAGAAAAGGAAAGAAAATGG + Intergenic
985330580 4:188827836-188827858 TTGTGGATGAGCAAAGAAGATGG + Intergenic
985483614 5:135869-135891 TTGAAGAAGAGCTAAAAAGTTGG + Intergenic
985934582 5:3086655-3086677 TTGAAAAAGAAGAACAAAGATGG + Intergenic
986071258 5:4286961-4286983 ATGGAAAACAGGAAAGAAGAGGG - Intergenic
986132855 5:4946890-4946912 TTGAAGAAGAGGAACAAGAAAGG - Intergenic
986143542 5:5054682-5054704 AAGAAAAAGAAGAAAGAAGAAGG + Intergenic
986213256 5:5694263-5694285 TTGAAGGAGAAGAAAGAACTTGG - Intergenic
986391053 5:7288684-7288706 AAGAAGAAGAAGGAAGAAGAAGG - Intergenic
986551474 5:8960900-8960922 TTTAGGCAGAGGAAAGAACATGG + Intergenic
986678401 5:10210878-10210900 TTTAAAAAGAGAAAGGAAGAAGG + Intergenic
986798619 5:11236824-11236846 CTGAACAAAAGGAAAGAAGCGGG + Intronic
986808305 5:11329669-11329691 TTGGAGACCAGGAGAGAAGAAGG + Intronic
986852098 5:11825492-11825514 CAGAAGAAGAGGAAAGAATGAGG + Intronic
986948342 5:13051160-13051182 TTGAAGACAAAGAAAGAAAATGG + Intergenic
987044682 5:14096068-14096090 TTGAAGATGGGGAGAGGAGAAGG + Intergenic
987102854 5:14607607-14607629 TTGAAGGAGAAGGAAGAATAAGG - Intronic
987265023 5:16244526-16244548 TTAAAGAAGATAAAAAAAGAAGG + Intergenic
987800609 5:22691852-22691874 TAGAAGAACAGAAAAAAAGAAGG + Intronic
988169896 5:27639871-27639893 TAGGAGAAGAAGAAAGAAAAGGG - Intergenic
988330364 5:29830284-29830306 TCAAAGAAGAGGAAACAAGATGG + Intergenic
988339587 5:29952899-29952921 TGATGGAAGAGGAAAGAAGAAGG - Intergenic
988346416 5:30042655-30042677 GTGAAGAGAAGGAGAGAAGAGGG + Intergenic
988403892 5:30799414-30799436 TTGCTGAAAAGGAAAGATGAAGG - Intergenic
988414839 5:30933237-30933259 AAGAAGAAAAGGAAAAAAGAGGG + Intergenic
988493931 5:31728405-31728427 TGGAAGAGGAGAAAAGGAGAAGG + Intronic
988573095 5:32391567-32391589 TTGAAAATGAGGAAAGAACTGGG - Intronic
988632089 5:32942416-32942438 AGGAAGAAGAAGAAAGAAGAAGG + Intergenic
988686407 5:33529823-33529845 TTAAAGAAGAGGCCTGAAGAAGG - Intronic
989003623 5:36786315-36786337 TATGAGAAGAGGAAAGAAGTAGG + Intergenic
989125716 5:38050701-38050723 ATGCAGAAGAGGAAGGCAGAAGG + Intergenic
989354515 5:40528420-40528442 TAGTAGAGGAGGAAGGAAGATGG - Intergenic
989555548 5:42790654-42790676 GTGAAGAAGAGAAGAAAAGAAGG + Intronic
989603377 5:43220849-43220871 TTGAAGAAGCCGAGAGAAGAAGG + Intronic
989631884 5:43493311-43493333 TTCATGAAGAGGAAAGGATAGGG - Intronic
990046988 5:51444914-51444936 CAGAAGAAGAGGAGAGGAGAAGG - Intergenic
990143991 5:52738025-52738047 TGGGAGAAGAAGTAAGAAGAAGG - Intergenic
990236756 5:53777243-53777265 TTCAAGAAGAGGATATAAAAAGG - Intergenic
990474409 5:56147872-56147894 AAGAAGAAGAAGAAAGGAGAAGG - Intronic
990503413 5:56420557-56420579 TTAAAGAACAGGAAGGAATAAGG - Intergenic
990876581 5:60493303-60493325 TTGAAGGAGGAGAAAAAAGAGGG + Intronic
990889911 5:60636677-60636699 TAGTGGAAGAAGAAAGAAGAAGG - Intronic
990916165 5:60907788-60907810 TTGAAGAGGAGGAAAGATTAGGG - Intronic
991193106 5:63898883-63898905 TAGAACAGCAGGAAAGAAGAAGG + Intergenic
991379897 5:66009361-66009383 ATGAATGAGAGAAAAGAAGATGG + Intronic
991513531 5:67407490-67407512 AAGAAGAAGAGAAGAGAAGAGGG - Intergenic
992078456 5:73213242-73213264 AAGAAGAAGAAGGAAGAAGAAGG + Intergenic
992111995 5:73503635-73503657 TTGAAGAATAGGAATGCAGGAGG + Intronic
992133615 5:73720344-73720366 TTGAAAAAGAAGAAAAAGGAAGG + Intronic
992428793 5:76687048-76687070 TTGAAAAAGAAGAAAGAAGTTGG - Intronic
992765919 5:79999915-79999937 GTTAGGAAGAGGAAAGAACAGGG + Intronic
992942178 5:81773333-81773355 TTGGAGAAGAGAGAATAAGAGGG - Intergenic
993153659 5:84193467-84193489 TTCAAAAAGAGGTAAGAAGTAGG + Intronic
993180084 5:84541445-84541467 GTGAAGGAGAGGAAAGCACATGG - Intergenic
993416052 5:87633053-87633075 TTGAAGGAGAAGAAAAAAGTTGG + Intergenic
993525507 5:88960823-88960845 TTCATAAAGAAGAAAGAAGAAGG + Intergenic
993529279 5:89004334-89004356 TTTAAGCAGAGGAAAGATTATGG + Intergenic
993540456 5:89143695-89143717 TTGGAAAAGAGGAAAAAAGCAGG + Intergenic
993603433 5:89957354-89957376 TTTAAGAATAGCAAAGAAGAGGG + Intergenic
993826440 5:92692990-92693012 ATGCAATAGAGGAAAGAAGAAGG + Intergenic
993903454 5:93599276-93599298 GTGAAAAGGAGGAAGGAAGAAGG + Intergenic
993947158 5:94129570-94129592 CTGAACAGGAGGAAAGAACATGG + Intergenic
994114884 5:96050770-96050792 TTGAGGAAGGGGATAGCAGATGG + Intergenic
994206464 5:97041949-97041971 TTGAAAAATAGGAAAGACGCTGG - Intergenic
994326430 5:98451676-98451698 TTGAAGAAGACAAAAGCAGAAGG + Intergenic
994433236 5:99695470-99695492 GAGAAGGAGAGAAAAGAAGAAGG - Intergenic
994541061 5:101098008-101098030 TTGAAGAAGAATAAAGTTGATGG - Intergenic
994703728 5:103172512-103172534 TAGAAGAGGAGAAAGGAAGAAGG - Intronic
994868540 5:105313294-105313316 TTGAAAAAGAAGAAAGTTGAAGG - Intergenic
994913679 5:105945617-105945639 AAAAAGAAGAAGAAAGAAGAGGG + Intergenic
995336201 5:111002403-111002425 TGGAGAAATAGGAAAGAAGAGGG - Intergenic
995502700 5:112825255-112825277 TTGTAGAACAGGAGAGACGATGG - Intronic
995513389 5:112930138-112930160 TTGAAGATGAGGAAGGAAATGGG - Intergenic
995516630 5:112960620-112960642 TGGAAGAAGAGAGAAGAAGCAGG - Intergenic
995638763 5:114228020-114228042 ATGATGATGATGAAAGAAGAAGG + Intergenic
995887982 5:116917666-116917688 TTGATGAAGAGGATTAAAGACGG - Intergenic
995991443 5:118245003-118245025 TGGGAGAAGAGGGAAGAAGCAGG + Intergenic
996150192 5:120024778-120024800 TTGAGGAAGAACAAAGAAGTAGG - Intergenic
996606568 5:125329977-125329999 AAGAAGAAGAAGGAAGAAGAAGG + Intergenic
996622800 5:125530111-125530133 TTGAAGAAGAGAAAAATAGGAGG - Intergenic
997004681 5:129803992-129804014 TTAAAGAAGAACATAGAAGATGG - Intergenic
997211072 5:132077091-132077113 CTGAAGTAGAGGAAGCAAGAGGG - Intergenic
997405358 5:133641916-133641938 AAGAAGAAGAAGAAAGAAGGAGG - Intergenic
998410465 5:141906712-141906734 AGGAAGAAGAAGGAAGAAGAAGG + Intergenic
998616526 5:143746524-143746546 TTGAATAAGAGAAAGGAATAGGG - Intergenic
998716121 5:144886612-144886634 GTGAAGAAAAAAAAAGAAGAAGG + Intergenic
998731077 5:145077943-145077965 TAAAAGAAAAGAAAAGAAGAAGG - Intergenic
998901090 5:146855597-146855619 TTTAATAAAAGGAACGAAGAGGG - Intronic
999321917 5:150620627-150620649 TGGATGGAGAGGACAGAAGAAGG + Intronic
999444673 5:151629846-151629868 AAGAAGAAGAAGAAAGAAGAAGG + Intergenic
999570145 5:152910658-152910680 TGGAGGAGGAAGAAAGAAGAGGG - Intergenic
999884520 5:155906250-155906272 CTCAAGAAGAGGAAATGAGAGGG - Intronic
1000149240 5:158483440-158483462 TTGAAGAAAAAAAAAAAAGAAGG + Intergenic
1000185102 5:158851479-158851501 GGGAAGGGGAGGAAAGAAGAGGG + Intronic
1000187074 5:158869491-158869513 TTGGAGAAGAGGAAATAGGAGGG - Intronic
1000378956 5:160611762-160611784 ATGGAGAAAACGAAAGAAGACGG - Intronic
1000557642 5:162746008-162746030 TTGAACAAGAGCAAAGCTGAAGG + Intergenic
1000586109 5:163100913-163100935 TTAAAGAAATGGAAAGAACATGG - Intergenic
1000633656 5:163619054-163619076 ATGAAGAAGAAAAAGGAAGAGGG - Intergenic
1000783368 5:165512552-165512574 TTGCAGAAGTGGAAAGAATGTGG - Intergenic
1001041908 5:168342225-168342247 TTGGAGCAGAGGAAGGGAGAGGG + Intronic
1001132966 5:169079752-169079774 AGGAGGAAGAGGGAAGAAGAGGG + Intronic
1001154501 5:169261526-169261548 TTTAAAAAAAGGAAAGGAGATGG - Intronic
1001200551 5:169712158-169712180 GTGAAGCTGATGAAAGAAGATGG + Exonic
1001316711 5:170647325-170647347 CTGAAGAAGAAGAAAAAAGTTGG + Intronic
1001321172 5:170683005-170683027 TTAAAGCAGGGGAAGGAAGATGG - Intronic
1001444850 5:171775221-171775243 TTGAATTTGAGGAAAGAAGGTGG - Intergenic
1001594807 5:172891341-172891363 ATGGAGAAGAGGGAAGAGGATGG - Intronic
1001682226 5:173566681-173566703 TTACAGATGAGGAAAGCAGAGGG - Intergenic
1001695900 5:173669598-173669620 CAGAAAAAGAGGAAAGAAGGAGG - Intergenic
1001767032 5:174257910-174257932 TTGGACAAGAGCAAGGAAGAAGG - Intergenic
1001996849 5:176168757-176168779 TTGAGGGAGAGGTAGGAAGAAGG + Intergenic
1002482212 5:179510095-179510117 AGGAAGAGGAAGAAAGAAGAAGG - Intergenic
1002606456 5:180385586-180385608 GTTAAGGAGAGGAAATAAGAGGG + Intergenic
1002969131 6:1996122-1996144 AGGAAGAAGAGGAAGGAGGAAGG - Intronic
1003540259 6:7012461-7012483 AGGAAAGAGAGGAAAGAAGAAGG + Intergenic
1003856962 6:10286348-10286370 AAGAAGAAGAGAAAAGAAAAAGG + Intergenic
1004368474 6:15031865-15031887 GAGAAGAAGAAGAAAGAGGAGGG + Intergenic
1004394938 6:15239413-15239435 TTGGAGAGGATGACAGAAGAAGG + Intergenic
1004442594 6:15668207-15668229 CTGAAGAACAGGAGAGAAGGGGG + Intergenic
1004443236 6:15673502-15673524 TTAAAGAAGTAGAAAGAAGTGGG + Intergenic
1004463804 6:15864521-15864543 GTGATGAAGTGGAAAGAATAAGG - Intergenic
1004680611 6:17890623-17890645 TTGAAAAAAAAAAAAGAAGAAGG - Intronic
1004963679 6:20822269-20822291 TTGAACAACAGGAAAGTAGTTGG + Intronic
1005286549 6:24333856-24333878 TGGCAGAAGTGGAGAGAAGAGGG + Intronic
1005356988 6:24994571-24994593 CTGTAGAAGAGCAAAGAAGAAGG + Intronic
1005515389 6:26549777-26549799 TGGAAGAGTTGGAAAGAAGAGGG + Intergenic
1005852367 6:29831154-29831176 TTGCAGGAGAGGAGAGTAGATGG + Intergenic
1005927789 6:30458275-30458297 GTGAAGCAGAGCAAAGAAGGCGG - Intergenic
1006020652 6:31115830-31115852 TTTGAGAAGAGGAAGGAGGAAGG + Exonic
1006195999 6:32242808-32242830 TGGATGAAGAGGGAAGGAGATGG + Intergenic
1006302782 6:33202593-33202615 AAGAAGAAAAGGAAACAAGAGGG + Exonic
1006505523 6:34486375-34486397 TTGAAGATGAGAAAACAGGAAGG + Intronic
1007021811 6:38528529-38528551 TTTGAGAAGAGGAGAGGAGAAGG + Intronic
1007056746 6:38893373-38893395 TAGAAGAGAAGGAAAGAAGCAGG + Intronic
1007364007 6:41377396-41377418 AGAAAGAAGAGAAAAGAAGAAGG + Intergenic
1007519042 6:42437402-42437424 ATGCAGAAGAGTAAAGAATATGG + Intronic
1007748252 6:44056484-44056506 CTGAAGAAGGAGAAAGGAGATGG + Intergenic
1008057810 6:46963337-46963359 TTGCAGAAGAGGAAAGGACAAGG - Intergenic
1008139140 6:47811721-47811743 TTCATGAAGAGGTATGAAGATGG + Exonic
1008349319 6:50471309-50471331 ATGAAGAAGAGGAGAGGTGATGG - Intergenic
1008619364 6:53256863-53256885 TTGGAGAAGGGAAAAGAACAAGG + Intergenic
1008704338 6:54139415-54139437 TTAATGAAGAGGAAAGAAGTTGG + Intronic
1008800492 6:55362978-55363000 AGGAAGAAGAGGAAACAGGAAGG + Intronic
1008874245 6:56308250-56308272 TGGCAGAAGATGGAAGAAGATGG - Intronic
1008890974 6:56489900-56489922 TTGAACAAGAAGAAAGTATAAGG - Intronic
1008999454 6:57696759-57696781 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1009244136 6:61213981-61214003 TGGGTGAAGAGGAAAGAAGGAGG + Intergenic
1009339570 6:62537085-62537107 ATAAAGAAGAGGAAGTAAGAAGG - Intergenic
1009387678 6:63105850-63105872 TTGAAGAAGACATAAGAAAATGG - Intergenic
1009589609 6:65649457-65649479 TTGATGAAGAGTAAACAATAAGG - Intronic
1009779156 6:68246887-68246909 TTGAAGAATAGGAAGGATGCTGG - Intergenic
1009886728 6:69632117-69632139 TAGAAAAAGAGGAAAGATGCAGG + Intergenic
1010091410 6:71986988-71987010 TTGGAGAAGAGGATAAATGATGG + Intronic
1010422771 6:75692964-75692986 TGGAGGAAGAGGTAAGAGGATGG + Intronic
1010457971 6:76081069-76081091 TGGAAGATGAGGAAAGCTGAAGG - Intergenic
1010485669 6:76410457-76410479 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1010567256 6:77431381-77431403 TTGCAGAAGAGGAAAGATGGGGG - Intergenic
1010726805 6:79344325-79344347 TAAAAGAAGTGAAAAGAAGAGGG + Intergenic
1010801060 6:80176168-80176190 TTTAAGGAGGGGAAAGGAGAAGG + Intronic
1011094654 6:83646640-83646662 TTGAAGAAGAACAAAGTTGAAGG - Intronic
1011627105 6:89291559-89291581 GTGAGGAAAAGGCAAGAAGAAGG - Intronic
1012116414 6:95304034-95304056 TTGAAGGAGTTGATAGAAGATGG - Intergenic
1012153948 6:95793066-95793088 TTGAAGAAAAAGAAAGAAACAGG + Intergenic
1012385743 6:98680068-98680090 TTGAAGAAAATGAGAAAAGAGGG + Intergenic
1012529718 6:100220904-100220926 ATGAAGATGAGGAAAGAATTAGG - Intergenic
1012549229 6:100452601-100452623 ATGAAGAAGAGGAAATAAATTGG + Intronic
1012556915 6:100524791-100524813 TTGAAGAGGAGGAAGGATAAAGG - Intronic
1012574894 6:100782256-100782278 TTAAAGAATAGAAAAGAAAAAGG + Intronic
1012670498 6:102039657-102039679 TTGAAAAAGAGAAACCAAGAAGG - Intronic
1012736469 6:102951806-102951828 TTGAGGTAGAGGAAATAATATGG - Intergenic
1012873290 6:104696523-104696545 CTGCAGAAGAGGAAAGGGGAAGG + Intergenic
1012915602 6:105167166-105167188 TTGAAACAGAGGAACGAAGAAGG + Intronic
1013021428 6:106224458-106224480 TTGAAGAAAAGTAAAGAAAGAGG + Intronic
1013193685 6:107826322-107826344 GGAAAGAAAAGGAAAGAAGATGG + Intergenic
1013688520 6:112613022-112613044 GGGAAGATAAGGAAAGAAGAGGG + Intergenic
1014534102 6:122595974-122595996 TTGCAGAAGAGGTAAGTGGATGG - Intronic
1014590889 6:123268012-123268034 TTGTATAAGAGGATAGAATATGG + Intronic
1014604602 6:123457109-123457131 TTGTAAAAGACCAAAGAAGAAGG - Intronic
1014748457 6:125228211-125228233 TTGGGGGAAAGGAAAGAAGAGGG + Intronic
1014784652 6:125604560-125604582 TTGAAGAAGAAGAACAAAGTTGG + Intergenic
1014883765 6:126754951-126754973 CTGAACAAGAGGAAAGAGAATGG + Intergenic
1014886296 6:126785407-126785429 ATGAAGAGTAGGAAGGAAGAAGG - Intergenic
1015275285 6:131377741-131377763 TTGAAGAAGGAGAAAGGGGAGGG - Intergenic
1015416795 6:132958201-132958223 AGGAAGAAAAGGAGAGAAGAAGG + Intergenic
1015435946 6:133188311-133188333 TTGAAAAAAAGGATAGAAGCTGG + Intergenic
1015600697 6:134907300-134907322 TGTAAGATGAGGAAAGTAGATGG - Intergenic
1015648667 6:135427509-135427531 TTGAAGAGGTAGAAAGTAGAAGG - Intronic
1016365690 6:143315374-143315396 TTGAAGAAGAACAAAGTAGGAGG + Intronic
1017221988 6:151976203-151976225 CAGAAGAACAGGGAAGAAGAGGG + Intronic
1017389279 6:153922025-153922047 TTTAAAAAGAGGAAAGAAAAGGG - Intergenic
1017546458 6:155456523-155456545 TTAAAGAAGTGGAAAAAATATGG - Intergenic
1017608268 6:156156323-156156345 GTGAAGAAGAGGAAGACAGAGGG + Intergenic
1017635743 6:156441534-156441556 GAGAAGAAGAGGAATGAAGCAGG + Intergenic
1018242299 6:161789599-161789621 TTGAAGAAAGGTAAAGAAAAAGG - Intronic
1018258686 6:161948530-161948552 TGAAAGAAGAGTAAAGAAGGAGG + Intronic
1018392558 6:163351526-163351548 TGGAAGGAGAGGCTAGAAGAAGG + Intergenic
1018451323 6:163910847-163910869 AGGAAGAAGAGGAAGAAAGAAGG - Intergenic
1018489947 6:164281850-164281872 TTTAAAAAAAGGAAAGAAAAGGG - Intergenic
1018599035 6:165519011-165519033 TTGAATAAAAAGAAAGATGAGGG + Intronic
1018638639 6:165886571-165886593 TTGAACAAGAAGAAATCAGAAGG + Intronic
1018831939 6:167449948-167449970 TGGAAGGAGAGGAAGTAAGAAGG + Intergenic
1019026342 6:168967178-168967200 ATGAACAAGAGGAAAAAAAAAGG - Intergenic
1019484066 7:1280423-1280445 AGGAAGAAGAAGAAGGAAGAAGG + Intergenic
1019797661 7:3063691-3063713 AGAAAGAAGAAGAAAGAAGAAGG - Intergenic
1020050324 7:5077024-5077046 AGGAAGAAAAGGAAGGAAGAAGG - Intergenic
1020372906 7:7453853-7453875 CTGAAGAAGAGGAAAAGGGAAGG - Intronic
1020402348 7:7793405-7793427 GTGAAGTAGTGGAAAGAACAGGG - Intronic
1020462691 7:8442561-8442583 TTGTAGAAGACGAAGGAAAATGG - Intronic
1020577346 7:9949887-9949909 AAGAAGAAGAAGAAGGAAGAGGG + Intergenic
1020589542 7:10117342-10117364 TTGAAAAAAAAGAAAGAAGAAGG - Intergenic
1020690291 7:11346671-11346693 GTGAAGAAGAGAAGAGAGGAGGG - Intergenic
1020899053 7:13980556-13980578 GGGAAGAGGAGGAAAGGAGAAGG + Intronic
1021142425 7:17044071-17044093 GGGAAGAAAAGGAAAAAAGAGGG - Intergenic
1021163772 7:17308209-17308231 GTGAAAGAGAGAAAAGAAGAAGG - Intronic
1021294201 7:18884041-18884063 TTGAAGAAGATGTAAGTAAATGG + Intronic
1021672661 7:23047525-23047547 AGGAGGAAGAAGAAAGAAGAAGG - Intergenic
1021982342 7:26067057-26067079 TTGAAGAGGGGAAAAGAAGGTGG - Intergenic
1022150749 7:27602533-27602555 TTGAAAAATAGGTAACAAGAGGG - Intronic
1022192671 7:28032206-28032228 TTAAAGAAGAGAGAAGGAGAAGG - Intronic
1022346484 7:29520169-29520191 TTGAAGAAGAGGAACAAGAATGG - Intergenic
1022551907 7:31248752-31248774 GTGAAGAAGGAGAAAGAAGCAGG - Intergenic
1022564123 7:31380061-31380083 TTTAATAAGTGGAAAGAATATGG + Intergenic
1022617386 7:31945767-31945789 CTGAAGGAGAGGAAAGAGAATGG - Intronic
1022789098 7:33669001-33669023 TTGAGGGAGAGGAAAGAGCATGG + Intergenic
1022809762 7:33857318-33857340 TTGAGGAAAAGGAAACAGGAGGG + Intergenic
1023214496 7:37847531-37847553 AAGAAGAAGGAGAAAGAAGAAGG + Intronic
1023237661 7:38107405-38107427 TTGAAGAGGAGGGAAGAAAAGGG + Intergenic
1023353993 7:39349310-39349332 GTGAAGAAAAGGAAGGAAGAAGG - Intronic
1023541453 7:41270956-41270978 TTGAAGCAGAGGGAGGAAAAAGG - Intergenic
1024023461 7:45391525-45391547 TTGACAAAGAAGGAAGAAGAGGG + Intergenic
1024032258 7:45471412-45471434 AAGAAGAAGAAGAAAGAAGGAGG + Intergenic
1024203888 7:47135455-47135477 GAGAAGAAAAGGAAAGAGGAAGG - Intergenic
1024438243 7:49384152-49384174 TTAAAGAAAATGAAAGCAGAAGG - Intergenic
1024999546 7:55303652-55303674 AAAAAGAAGAAGAAAGAAGAAGG + Intergenic
1025011922 7:55404304-55404326 TAAAAGAAGAAGAAAGAAGGAGG - Intronic
1025888002 7:65616775-65616797 GTGAAAAGGTGGAAAGAAGAAGG - Intergenic
1026183828 7:68065524-68065546 CAAGAGAAGAGGAAAGAAGAAGG + Intergenic
1026211658 7:68311307-68311329 TTGACAAAGAAGAGAGAAGATGG + Intergenic
1026251047 7:68670974-68670996 TAGAATAAGAAGAAAGGAGATGG - Intergenic
1026349609 7:69504173-69504195 TTGAAGATGCGGGAAGTAGAGGG + Intergenic
1026537224 7:71248917-71248939 GTAGAGAAGAGGCAAGAAGATGG - Intronic
1026905095 7:74058340-74058362 GAGAAGGAGAAGAAAGAAGAAGG - Intronic
1027392736 7:77721715-77721737 TTGAAGAAAAGGCTAAAAGAAGG + Intronic
1027483092 7:78723949-78723971 TGGAGAAAGAGGAAAAAAGAAGG + Intronic
1027849177 7:83427231-83427253 TTGAAGAAAAAGAAAGAGAAAGG - Intronic
1027970804 7:85078682-85078704 TAGAAGATGAGGAAACAAAAGGG - Intronic
1028042584 7:86073532-86073554 GGGAAGAAGAGAGAAGAAGAGGG - Intergenic
1028387224 7:90269756-90269778 GTGAAGAAAAAGAAAGAAGATGG + Intronic
1028390545 7:90311592-90311614 AGGAGGAGGAGGAAAGAAGAAGG - Intergenic
1028753525 7:94409478-94409500 GGGAAGAAGAAGAATGAAGATGG + Intronic
1028753530 7:94409539-94409561 ATGAGGAAAAGGAAAGGAGAAGG - Intronic
1028804903 7:95013981-95014003 TTCAAAAAGAAAAAAGAAGAAGG - Intronic
1029519483 7:101051057-101051079 TGGCAGAAGAGGGAAGAAGGAGG + Intronic
1029578307 7:101418845-101418867 GTGGAGAGGAGGAAAGAGGAAGG - Intronic
1029646508 7:101860083-101860105 AGGAAGAAGAGGATAGGAGAGGG - Intronic
1029692503 7:102191583-102191605 TTTTGGAAGAGGGAAGAAGAGGG - Intronic
1030157021 7:106465614-106465636 TGGAAGAATTGGAAAGGAGAGGG + Intergenic
1030846664 7:114423367-114423389 TTAAAAAAGAAGAAAGAAAAAGG + Intronic
1030934604 7:115569824-115569846 TTTAGGAAGAGAAAGGAAGAAGG - Intergenic
1031041162 7:116839782-116839804 ATGAGGAAGAGGAAAGATGAGGG + Intronic
1031044018 7:116866906-116866928 TTGTGTGAGAGGAAAGAAGATGG - Intronic
1031158794 7:118141947-118141969 AAGAAAAAGAGGAAAGTAGAGGG - Intergenic
1031291224 7:119938427-119938449 TTGGGTAAGAGGAAAGAATAAGG - Intergenic
1031320427 7:120319610-120319632 ATGAAGAAGAGGTAAAAACATGG - Intronic
1031374396 7:121006508-121006530 CTAAGGAAGAGGAAAGCAGAGGG + Intronic
1031380622 7:121081486-121081508 TAGGAGAAGTGGAAAGAAAATGG - Intronic
1031433476 7:121703639-121703661 TTGAAGAAGACATAAGAAAATGG + Intergenic
1031441996 7:121805992-121806014 TTGAAGAAGAGGCAAATAAATGG - Intergenic
1031618574 7:123908916-123908938 AAGAAGAAGAAGAAGGAAGAAGG + Intergenic
1031756516 7:125650308-125650330 TTTAAGAAGAAGAAAAAAGCTGG + Intergenic
1031944125 7:127820717-127820739 TTGAGGAGGAGGAAGGAAAATGG - Intronic
1032345331 7:131110846-131110868 CTGAAGATGAGGAGAGAAGCGGG - Intronic
1032430705 7:131859041-131859063 GTGAACCAGAGGAAGGAAGAGGG + Intergenic
1032696700 7:134342951-134342973 TTGATTAAGAAGAAAGAAGAAGG - Intergenic
1032743182 7:134760041-134760063 TTTGGGCAGAGGAAAGAAGATGG + Intronic
1032964613 7:137081342-137081364 ATAAAGAAAAGGAAAGAAAAAGG - Intergenic
1033085367 7:138336364-138336386 TGGAGGAAGAGGAGAGGAGAGGG - Intergenic
1033282301 7:140014916-140014938 AAGAAGAAGAAGAAAGAAGGAGG + Intronic
1033395788 7:140972659-140972681 TTGAAGATGATGAATAAAGAAGG + Intergenic
1033890469 7:146006537-146006559 TAGAAGAAGAAGAAGGAGGAGGG - Intergenic
1034111165 7:148538892-148538914 TTAAAGAAAAGGGAAGAAGAAGG - Intergenic
1034271935 7:149807388-149807410 GTGAAGAAAAAGAAAAAAGAGGG - Intergenic
1034507144 7:151501859-151501881 GGGAAGAGGAGGCAAGAAGATGG + Intronic
1034604105 7:152294892-152294914 AACAAGAAGAGAAAAGAAGATGG - Intronic
1034843278 7:154419599-154419621 TTCAAGAGAAGGAAAGAAAAAGG - Intronic
1035050299 7:155994824-155994846 TAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1035419682 7:158717224-158717246 TAGGAGAAGAAGGAAGAAGAAGG - Intergenic
1035419700 7:158717317-158717339 GAGAAGAAGAAGGAAGAAGAAGG - Intergenic
1035419735 7:158717518-158717540 GAGAAGAAGAAGGAAGAAGAAGG - Intergenic
1035419803 7:158717840-158717862 GAGAAGAAGAAGGAAGAAGAAGG - Intergenic
1035814165 8:2520990-2521012 TGGTTGAAGAGGAAGGAAGACGG - Intergenic
1036743207 8:11384997-11385019 TTGAAAAAGAAGAATGAAGTAGG + Intergenic
1037071579 8:14656632-14656654 TGAAAGGAGAGGAAAGGAGAGGG - Intronic
1037091694 8:14927533-14927555 AGGAAGAGGAAGAAAGAAGAGGG + Intronic
1037219779 8:16504607-16504629 TTGAAGAAAAGGAAAGGGGAAGG + Intronic
1037260598 8:17002707-17002729 TAGAAGAAGAGGAAGGGAGGAGG + Intergenic
1037277727 8:17199745-17199767 AAAAAGAAGAAGAAAGAAGAAGG - Intronic
1037804813 8:22053397-22053419 CTGAAGAAAAGGAAGGATGAGGG - Intronic
1038080990 8:24135918-24135940 TAGAAGCAGAGGAAAGAAAAGGG + Intergenic
1038113393 8:24525158-24525180 TTTATGAAGAGGATAGAGGATGG - Intronic
1038317174 8:26496278-26496300 CTCAAGAAAAGGAAAAAAGAAGG + Intronic
1039008942 8:33072261-33072283 TTCATGAAAAGGAAAGATGAAGG + Intergenic
1039317329 8:36387885-36387907 AAGAAGAAGAGGAAAGAAGGAGG - Intergenic
1039670836 8:39595867-39595889 TTGGAGAAATGGAAACAAGAAGG - Intronic
1039744109 8:40408278-40408300 GAAAAGAAAAGGAAAGAAGAAGG - Intergenic
1039806199 8:41001795-41001817 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1039873768 8:41568250-41568272 TAGATGGAGAGGAAAGTAGAAGG - Intergenic
1039920797 8:41893072-41893094 GTGAAGCAGAGGATAGAAGAGGG - Intronic
1039938631 8:42069747-42069769 TTAAAGAAAAGAAAAGAAAACGG - Intergenic
1040370807 8:46771353-46771375 TTAAAGAAAAGGAAAGGAAATGG - Intergenic
1040398026 8:47018311-47018333 TGGAAGAGGAAGACAGAAGATGG + Intergenic
1040835227 8:51723955-51723977 GTGGAGAAGAGGAAATAAGATGG + Intronic
1041156884 8:54996654-54996676 TGGAAGGAAAGGAAAGAAGCTGG - Intergenic
1041248765 8:55914410-55914432 TGGAAGAAGAAAAAAGGAGAAGG + Intronic
1041301354 8:56415190-56415212 TAAAAGAATAGGAAAGAAGGTGG - Intergenic
1041392917 8:57363063-57363085 TGGAAGAAGGAGAAAGAACATGG - Intergenic
1041437020 8:57853132-57853154 TTGAAGATGAGGGAAGGGGAAGG + Intergenic
1041585849 8:59517963-59517985 TAGATGAAGAGGAAAGGAAATGG + Intergenic
1041617069 8:59919654-59919676 TTAAAGAAGATGAAAGAAAAGGG - Intergenic
1041724163 8:61002857-61002879 TGGTAGAAAAGGAAATAAGAAGG + Intergenic
1041733211 8:61083750-61083772 TTTCAGAAGAAGAAAAAAGATGG + Intronic
1041880302 8:62741963-62741985 TTGTAGAATAAGGAAGAAGAGGG - Intronic
1042264598 8:66895372-66895394 AAGAAGAAGAAGAAGGAAGAAGG - Intronic
1042323269 8:67501006-67501028 TTGAAAAAGAAGAATGAAAAGGG - Intronic
1042334117 8:67612480-67612502 TTGAGAAAGAAGAAAGGAGAAGG - Intronic
1042454401 8:68983814-68983836 TGGAAGAAGGGGAATGAAGTCGG + Intergenic
1042579608 8:70262436-70262458 TTTACAAAGAGGAGAGAAGATGG + Intronic
1042602164 8:70509845-70509867 GTGAAGAAGAGCAAAGTTGAAGG - Intergenic
1042935156 8:74051061-74051083 TAGTAATAGAGGAAAGAAGATGG + Intergenic
1043033204 8:75164844-75164866 ATGAGGAAGAAGAAAAAAGATGG + Intergenic
1043057297 8:75454730-75454752 TTAATGAAGAGAAATGAAGAAGG - Intronic
1043060319 8:75492242-75492264 TAGAAGAGGAGGAAACAAGTAGG - Intronic
1043503952 8:80884610-80884632 AGGAAGAAGAAGAAAGAGGAAGG + Intergenic
1043700260 8:83278237-83278259 TTGAAGAAAAGGAATAAAGGTGG - Intergenic
1043731820 8:83693485-83693507 TTGAAGAAGAGGATGGCAGAGGG + Intergenic
1044034462 8:87283099-87283121 TAGAAGAAATGGAAATAAGAAGG - Intronic
1044044369 8:87412788-87412810 ATCAAGAAGAGGAGAAAAGAGGG + Intronic
1044429429 8:92091154-92091176 TTGTAGAAGAGGAATGCAGAGGG - Intronic
1044589552 8:93900549-93900571 ATGAAGGAAAGGAAAGCAGAGGG - Intronic
1044732764 8:95244349-95244371 TTTAAGAATATGAAAGAAAAAGG - Intergenic
1044772483 8:95651327-95651349 TTGAAGAATAGGAAAAAGAAGGG - Intergenic
1045085405 8:98677535-98677557 AGGAGGAAGAGGAAGGAAGAAGG + Intronic
1045281126 8:100750554-100750576 TTTAGGAAGAGGAGGGAAGAGGG + Intergenic
1045296163 8:100873156-100873178 TTGCAGGAGAGGGAAGATGAGGG - Intergenic
1045345173 8:101287603-101287625 TTCAAGAAGAGGAAAGAGCAGGG - Intergenic
1045382499 8:101641423-101641445 CTCAAGAAGAGGAAAGAATGGGG - Intronic
1045382852 8:101644192-101644214 TCAAAGCAGATGAAAGAAGAAGG + Exonic
1045617677 8:103937682-103937704 TTCCTGAAGAGGAAATAAGAAGG + Intronic
1045619971 8:103965098-103965120 TTGAAGGAGAAGAATGAAGTTGG - Intronic
1045628669 8:104088346-104088368 GGGAGGTAGAGGAAAGAAGAGGG - Intronic
1045635770 8:104186994-104187016 GGGAAAAAAAGGAAAGAAGATGG + Intronic
1045727919 8:105197090-105197112 TTGAGGAAGAGTAATGAAGGCGG - Intronic
1045739466 8:105338926-105338948 TTGATGAAGAGTAAATAAGTAGG + Intronic
1045797220 8:106060242-106060264 AGGAAGAGGAGGAAAAAAGAAGG + Intergenic
1045837031 8:106534812-106534834 TTAAAGAAGCAGAAAGAAAATGG + Intronic
1045932801 8:107646881-107646903 TTGAAAAAGAAGAATGAAGTTGG + Intergenic
1046126067 8:109910199-109910221 GGGAAGGAAAGGAAAGAAGAAGG - Intergenic
1046423116 8:114010550-114010572 TTGAGGGAGAGGCAAGGAGATGG - Intergenic
1046498099 8:115040253-115040275 TTGAAAAAGAAGAAATAAGATGG - Intergenic
1046531408 8:115450753-115450775 TTGAGGAAGAGGCAAGAATGAGG - Intronic
1046739588 8:117814025-117814047 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1046744767 8:117864895-117864917 TTGGAGAAGAGGAAGGAAGTAGG - Intronic
1046915610 8:119675259-119675281 TATAAGAAGAGGAAGGAACAAGG - Intergenic
1047022695 8:120792953-120792975 TGGAAGAAAAGAAAAGAAGGTGG + Intronic
1047028395 8:120849653-120849675 TTGAAATAGAGCAAAGCAGAAGG + Intergenic
1047305396 8:123649200-123649222 TTGAAAAATAGAAAAGAAGGAGG + Intronic
1047465480 8:125108940-125108962 TTAAAGTAGAGGAAAAAATATGG + Intronic
1047569925 8:126086397-126086419 TTGATCATCAGGAAAGAAGATGG + Intergenic
1047618724 8:126585093-126585115 TGGAAGGAGAGGAGGGAAGACGG - Intergenic
1047630747 8:126705218-126705240 ATTAAGAAGAGGAAGAAAGATGG + Intergenic
1047690931 8:127353900-127353922 GGAAAGAAGAAGAAAGAAGAAGG + Intergenic
1047827588 8:128594289-128594311 TTCAATAAGTGAAAAGAAGAAGG - Intergenic
1047874991 8:129126296-129126318 AAGAAGAAGAAGAAAAAAGAAGG + Intergenic
1047921089 8:129635202-129635224 TTGAAGTAGAGGGAGAAAGATGG + Intergenic
1048133220 8:131720222-131720244 TTGAGGCAGAGGAAAGAGAATGG - Intergenic
1048374131 8:133807468-133807490 TTGAAGAAAAAGAAAGGAGTGGG - Intergenic
1048458889 8:134603281-134603303 TTCAAGAAAAGGAAAGAGGGAGG + Intronic
1048680475 8:136835948-136835970 TTCAAGCAGAGGAAGGAGGAGGG - Intergenic
1048795943 8:138150076-138150098 TTGCAAAAGGGTAAAGAAGATGG + Intronic
1048876642 8:138841678-138841700 TTGACGAAGAGGAGGGAAGAGGG + Intronic
1048996579 8:139797939-139797961 TTGAAAAAGAAGAACGAAGTTGG - Intronic
1049047477 8:140164444-140164466 CTGAAGAGGAAGAAGGAAGAAGG - Intronic
1049179485 8:141214637-141214659 TTGAAGAAGAACAAAGTTGAGGG + Intronic
1049566280 8:143340764-143340786 TTCCAGAAAAGAAAAGAAGAGGG - Intronic
1049736442 8:144209240-144209262 TTGAAGAAGAATAAAGTTGAAGG - Intronic
1050139703 9:2504545-2504567 CTGAAGAAGAGGTAGGACGAAGG - Intergenic
1050169812 9:2803578-2803600 TTGAATAAGAAGGAAGAAGGTGG - Intronic
1050308553 9:4330200-4330222 TAGAAGGAAAGGAAAGAAGCAGG + Intronic
1050475917 9:6040967-6040989 GAGAAGAAGAAGAAAGAAGAAGG - Intergenic
1050496055 9:6243724-6243746 TTGGTGAACAGGAAAGAAAATGG + Intronic
1050831083 9:10014321-10014343 ATGGAGAAGTGGAAAGAATATGG - Intronic
1050930682 9:11320869-11320891 TTGAAGAAGGAAAGAGAAGAGGG - Intergenic
1050942169 9:11473144-11473166 AAGAAGCAGAAGAAAGAAGAAGG + Intergenic
1050942172 9:11473187-11473209 AAGAAGAAGAAGAAAGTAGAAGG + Intergenic
1050943043 9:11484858-11484880 ATGAAGATGAGGAAAAAACAGGG - Intergenic
1051145656 9:14024732-14024754 AGGAAGAATAGAAAAGAAGAAGG + Intergenic
1051301196 9:15652788-15652810 TTGAAAAAGAAGAATAAAGATGG - Intronic
1051352405 9:16210128-16210150 TTGAAAAAGAAGAAAGCTGAAGG - Intronic
1051432046 9:16989325-16989347 ATGATGAAGAGGAATGAGGAAGG - Intergenic
1051573852 9:18591889-18591911 TTGAAGAAGTGGTAAGCAGTTGG + Intronic
1051986245 9:23091097-23091119 TAGAAGAGAAAGAAAGAAGAAGG + Intergenic
1052236467 9:26217099-26217121 TTAAAGAACAGGAAAAAAAAGGG - Intergenic
1053229846 9:36399088-36399110 TTGATGAAGAGTAAACAAGATGG - Intronic
1053454247 9:38220160-38220182 TTGAAGAAGACAAAAAAAAAAGG - Intergenic
1054453995 9:65420305-65420327 TGGAAGGACAGGAGAGAAGAAGG + Intergenic
1055011278 9:71568816-71568838 TTGAAGAAGAGAATAAAGGAGGG + Intergenic
1055043599 9:71901706-71901728 TTGAATGAGAGGAATGAAGAGGG - Intronic
1055327355 9:75144635-75144657 TTGAGAAAAAGAAAAGAAGAAGG - Intronic
1055378040 9:75671798-75671820 TTGAAGAAGAAGAGGGAAGGGGG + Intergenic
1055382139 9:75719354-75719376 ATGAAGACAAGGCAAGAAGATGG - Intergenic
1055527782 9:77152742-77152764 TCAAAGAAGAAGAAAGAAGGAGG - Intergenic
1055752098 9:79517919-79517941 TTGAAGAAGAAAGAAGAACAAGG + Intergenic
1055770405 9:79710746-79710768 TAGTAGAAGAGGAAAGAATAGGG - Intronic
1055789604 9:79909687-79909709 TTGAACAAGAGGAACCAAGTTGG + Intergenic
1055954233 9:81759228-81759250 GGGAAGCAGAGGAAAGAAAAGGG - Intergenic
1056123521 9:83512664-83512686 TTCAAGAAGAGGTGAGCAGAAGG - Intronic
1056268684 9:84925181-84925203 AAGAAGAAGAGAAGAGAAGAAGG - Intronic
1056278257 9:85014231-85014253 TAGAAGAGAAGGGAAGAAGATGG + Intronic
1056513365 9:87327166-87327188 TCAAAGAAGAAGGAAGAAGAAGG + Intergenic
1056614090 9:88147897-88147919 TTGAAGAAGAACAAAGAAGTCGG + Intergenic
1056697627 9:88873345-88873367 AAGAAGAAGAAGGAAGAAGAAGG + Intergenic
1056849513 9:90070482-90070504 TTGAAGAAGAGCATGGAGGATGG + Intergenic
1057528883 9:95826751-95826773 TTGAAGGAGAGCAAAGAAATTGG - Intergenic
1057761411 9:97877655-97877677 CTGGAGAAGAAGAAAGAAGATGG + Intergenic
1058314868 9:103553593-103553615 TAGATGAAGGGGAAAGAAGATGG + Intergenic
1058407355 9:104691702-104691724 TTGAAGTAGAGGAAAGTGGAAGG - Intergenic
1058561474 9:106233333-106233355 AGGAGGAAGAGGGAAGAAGAAGG - Intergenic
1058561480 9:106233359-106233381 AGGAGGAAGAGGGAAGAAGAAGG - Intergenic
1058563024 9:106249745-106249767 AGGAAGAAGACGGAAGAAGAAGG - Intergenic
1058563027 9:106249883-106249905 AGGAAGAAGAAGGAAGAAGAAGG - Intergenic
1058563028 9:106249893-106249915 CAGAAGAAGAAGGAAGAAGAAGG - Intergenic
1058578858 9:106433052-106433074 TTCAAGAAGTAGAAAGAACATGG + Intergenic
1058663657 9:107289126-107289148 GGGAAGGAGAGGAAAGGAGAGGG - Intronic
1059503502 9:114777115-114777137 AAGAAGAGGAGGAAAAAAGAAGG - Intergenic
1059510184 9:114837897-114837919 TTGGTGAAGAAGAAAGATGAGGG - Intergenic
1059575381 9:115482625-115482647 TGGAAGGAGAGGAAAGAAAAAGG + Intergenic
1059713289 9:116889224-116889246 AAAAAGAAGAGGAAAAAAGAAGG + Intronic
1059756045 9:117294403-117294425 TTGTTGAAGAGGAGAGAGGAGGG + Intronic
1059929361 9:119245664-119245686 TTTAGGAAGAGGAAAGAGGAAGG - Intronic
1060000545 9:119954343-119954365 TTGAGAAAGAGAAAAGAACATGG - Intergenic
1060732346 9:126046714-126046736 AGGAAGAAGGGGAAGGAAGAGGG - Intergenic
1061251773 9:129430620-129430642 CTTAAAAAGAGAAAAGAAGATGG + Intergenic
1061638680 9:131933628-131933650 TTGAAGAAGACACAAAAAGATGG + Intronic
1062632358 9:137469827-137469849 ATGATGAACAGGAAAGAAAATGG + Intronic
1062638466 9:137503991-137504013 AGCAAGAAGAAGAAAGAAGAAGG + Intronic
1062638472 9:137504051-137504073 AGGAAGAAGAAGAAAGAAGAAGG + Intronic
1062638474 9:137504074-137504096 AAGAAGAAGAAGGAAGAAGAAGG + Intronic
1062638478 9:137504157-137504179 GAGAAGAAGACGGAAGAAGAAGG + Intronic
1203367448 Un_KI270442v1:271159-271181 TTGATGAAGATGAGTGAAGACGG - Intergenic
1203572686 Un_KI270744v1:146580-146602 AAGAAGAAGAAGAAAGAAGAAGG - Intergenic
1185552037 X:990217-990239 TTGACAAAGAGGAGGGAAGATGG - Intergenic
1185830057 X:3292881-3292903 AGGAAGAAGAAGGAAGAAGAAGG + Intergenic
1186020683 X:5251567-5251589 TTCAACATGAAGAAAGAAGATGG + Intergenic
1186312920 X:8339779-8339801 AAGAAGAAAAAGAAAGAAGAGGG + Intergenic
1186470559 X:9818761-9818783 GTGAAGAAAAAGAAAGAAGAGGG - Intronic
1186619526 X:11224180-11224202 AAGATGAAGAAGAAAGAAGAAGG + Intronic
1186619530 X:11224242-11224264 AAGATGAAGAAGAAAGAAGAAGG + Intronic
1186835027 X:13429033-13429055 AAGAAGAAGAAGAAAGAAAAGGG - Intergenic
1187235763 X:17465558-17465580 TAGATGAAGAGGCAAGAATAGGG + Intronic
1187417902 X:19109045-19109067 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1187601354 X:20834581-20834603 TTAAAGAAGAGTAAAGTAGAAGG - Intergenic
1187824738 X:23323660-23323682 TGGAAGAAGAAGAAGGAGGAGGG - Intergenic
1187831235 X:23383478-23383500 TTCCAGAAGAGGAAAGAATTTGG + Intronic
1187955047 X:24509261-24509283 TACAAGAAGAGGGAAGAAAAAGG - Intronic
1187973275 X:24679949-24679971 ATGGAGAAGAGGAAAGGGGAAGG - Intergenic
1188061933 X:25611545-25611567 TGAAACATGAGGAAAGAAGAAGG + Intergenic
1188172434 X:26943903-26943925 TTGAAGTAGTGGAAAGTAGGAGG + Intergenic
1188215294 X:27469122-27469144 ATTAAGCAGAGGAAAGAAAAAGG + Intergenic
1188272661 X:28159835-28159857 TATAAGAAGAGGAAATAACAAGG - Intergenic
1188467481 X:30498518-30498540 AAGAAGAAGAGGAAAAAAAAAGG + Intergenic
1188637754 X:32456768-32456790 TTGAATAAGTGGAAAGATGGAGG + Intronic
1188673663 X:32912096-32912118 GGGAGGAGGAGGAAAGAAGAAGG + Intronic
1189372602 X:40440951-40440973 TTGAATAAGAGAAAAGAATCAGG - Intergenic
1189461378 X:41245866-41245888 TTGAAGAAAAGCAAAGAAATGGG + Intergenic
1189551872 X:42101851-42101873 TTGATGTGGAGGAAGGAAGAGGG + Intergenic
1189601741 X:42634138-42634160 TTGAAGAAAGAGAAGGAAGATGG + Intergenic
1189632994 X:42974967-42974989 TGGAAAAAGAGGGGAGAAGAAGG + Intergenic
1189736635 X:44077610-44077632 TTGAAAAAGAAGAAAAAAGTTGG + Intergenic
1189836250 X:45026111-45026133 TTGAAGAAAAGAAAAAAAGCTGG + Intronic
1189885278 X:45537639-45537661 TTGAAGAAGACACAAGAAAATGG + Intergenic
1190123415 X:47682757-47682779 AGGAAGAAGAGGAAGGAAGGAGG - Intergenic
1190243803 X:48677238-48677260 TTGCAGCAGGGGAAAGAAAAGGG + Intronic
1190360273 X:49642801-49642823 TTGAAAAAGAGGAAAAAGGTGGG - Intergenic
1190515924 X:51223519-51223541 GGGAGGATGAGGAAAGAAGAGGG + Intergenic
1190540391 X:51471459-51471481 TTGAAGGAGAGGCAAGAAATAGG - Intergenic
1190881867 X:54497054-54497076 TTGTAGAAGAGAAGAGAAGGAGG - Intergenic
1190913434 X:54792195-54792217 GAGAAGAAGAGGAAAGGAGAGGG + Intronic
1191058018 X:56263387-56263409 TAAAAGAAGGGAAAAGAAGATGG + Intronic
1191675647 X:63789620-63789642 TGGAAGAACAGTAAAGATGATGG + Intergenic
1191821800 X:65318383-65318405 AAGAAGAAGAAGGAAGAAGAAGG - Intergenic
1191875340 X:65789241-65789263 TTGAAGACTAGGAAACTAGAAGG - Intergenic
1192035393 X:67557514-67557536 TTGAAGAACAGCAAAGCTGAAGG - Intronic
1192162103 X:68796160-68796182 TTTAAGAGAAGGAAAGTAGAGGG - Intergenic
1192236890 X:69301771-69301793 TGGAAAAGGAGGAAAGGAGAGGG - Intergenic
1192242509 X:69344798-69344820 TTGAAAAAGAAGAAAAAAGATGG - Intergenic
1192272041 X:69589907-69589929 AAGAAGAAGAAGAAAGAAGAAGG - Intergenic
1192315477 X:70048070-70048092 GCAGAGAAGAGGAAAGAAGAGGG - Intronic
1192381823 X:70625296-70625318 TAGAAAAAGAGGACAGAAGAGGG - Intronic
1192434620 X:71135508-71135530 GTGGAGCAGAGGAAAGAGGAGGG - Intronic
1192825064 X:74687072-74687094 TTGAAGAAGACAGAAGAAAATGG - Intergenic
1193103000 X:77636897-77636919 AAGAAGAAGAAGAAGGAAGAAGG + Intronic
1193103028 X:77637045-77637067 AGGAGGAAGAAGAAAGAAGAAGG + Intronic
1193118966 X:77803431-77803453 TTGCAGAAAAGGAAATAAGAAGG - Intergenic
1193165158 X:78271886-78271908 CTGAAGAAGAGAAAAGGAAAAGG - Exonic
1193343445 X:80379483-80379505 TAGAAAAAGAGGGAAAAAGAGGG - Intronic
1193343934 X:80384030-80384052 TAGAAAAAGAGGGAAAAAGAGGG + Intronic
1193739110 X:85196512-85196534 TTGAAAAAGAGGAACAAAAATGG + Intergenic
1193792716 X:85835246-85835268 ATGAACAAGAGAGAAGAAGAGGG + Intergenic
1193817431 X:86121188-86121210 TTGAACAAGCAGAAAAAAGAAGG - Intergenic
1193971856 X:88065122-88065144 TTGTAGGAAGGGAAAGAAGAGGG - Intergenic
1194055189 X:89123313-89123335 TTGAAAAAGAGGACAGGACAAGG - Intergenic
1194526229 X:94980441-94980463 TGGAAAAAGAGGAATGAATAAGG + Intergenic
1194579907 X:95659320-95659342 TTGTAGAAGAGTACAGTAGAAGG + Intergenic
1195112569 X:101662057-101662079 ATGCAGAAGAAGAAAGAAAAGGG - Intergenic
1195319164 X:103707285-103707307 TTGAAGATGAGGAAAGTGAAAGG + Exonic
1195433788 X:104818829-104818851 TTAAAGAAGAGAAAACAGGAGGG + Intronic
1195539653 X:106048171-106048193 GTTTAGAAGAGGAAAAAAGAAGG - Intergenic
1195600878 X:106746524-106746546 TTGAAGGAAATGAAAGAAGTTGG + Intronic
1195920003 X:109974263-109974285 CTGAAAAAGTAGAAAGAAGATGG - Intergenic
1195933268 X:110101016-110101038 AAGAAGATGAGGGAAGAAGAAGG - Intronic
1196005886 X:110836761-110836783 ATGAAAAAGAGGAATGAGGAGGG + Intergenic
1196011647 X:110894427-110894449 CTGAAGAAGAAGAAAAAGGAAGG + Intergenic
1196411784 X:115427512-115427534 AGGAAGAAGAGGAAAGGAGTAGG + Intergenic
1196542151 X:116922465-116922487 TGGTTGAAGAGGGAAGAAGATGG - Intergenic
1196653659 X:118194610-118194632 ATGAAGAAAAGCAAAGCAGACGG + Intergenic
1196680314 X:118463485-118463507 TTGAAGAGAAGAAAAGAAGAGGG - Intergenic
1196918411 X:120561713-120561735 TTGAAAGAGATGAAAGAATAAGG + Intronic
1197136480 X:123066260-123066282 TTGTAGCAGAGGACAAAAGAGGG - Intergenic
1197351803 X:125390624-125390646 GTGAGGAACAGGAAAGAAGAAGG + Intergenic
1197826384 X:130594745-130594767 TTTATGAAGAGAAAAGAAAAGGG - Intergenic
1197904823 X:131413424-131413446 AAGAAGAAGAAGAAAGAAAAGGG + Intergenic
1197966300 X:132066001-132066023 AAGAACAAGAGGAAATAAGAGGG + Intergenic
1197997395 X:132392739-132392761 ATGGTGAAGAGGAAAGAGGAAGG - Intronic
1198054392 X:132979383-132979405 TGGAAGAAGAGAAAAAGAGATGG + Intergenic
1198229146 X:134673191-134673213 AGGAAGAAGAGGAAAGAGGGAGG + Intronic
1198581419 X:138069045-138069067 TTGAAGAAGGGGAGATAAAATGG - Intergenic
1198810783 X:140534179-140534201 TGGAAGAAGAGGAAGGAGGGAGG + Intergenic
1198887026 X:141350559-141350581 TTCAAGAAGAGGTTAGAAAATGG - Intergenic
1198978011 X:142359021-142359043 CAGAAGAAGATGAAAGAAGAAGG - Intergenic
1199073939 X:143509520-143509542 CTGGAGAAGATGAAAGAATAAGG - Intronic
1199113997 X:143968547-143968569 TTGAAGAAGAGAGAAAAGGAAGG + Intergenic
1199354891 X:146850596-146850618 TAGAACTAGAGGAAAGAAGAGGG - Intergenic
1199568603 X:149245198-149245220 TTGAACAAGAAGAAAGAATTAGG - Intergenic
1199623363 X:149718331-149718353 CTGGAGATGAGGAAAGAACATGG + Intergenic
1199723647 X:150561474-150561496 TTGAAAAAGAAGAATGAAGTTGG - Intergenic
1199751538 X:150824078-150824100 AGGAAGAAGAAGAAAGAAGAAGG + Intronic
1199751568 X:150824223-150824245 AGGAAGAAGAAGAAAGAAGAAGG + Intronic
1199751596 X:150824546-150824568 AGGAAGAAGAAGAAAGAAGGAGG + Intronic
1199860428 X:151796432-151796454 GTGAAGAAGAGGAAAGAGGAAGG - Intergenic
1200691282 Y:6307670-6307692 ATCAAGAAGAAGAAAGAGGATGG - Intergenic
1200825908 Y:7640366-7640388 TTTAAAATAAGGAAAGAAGAAGG - Intergenic
1200957043 Y:8960123-8960145 TTTAAAATGAGGAAAGAAGAAGG + Intergenic
1201043990 Y:9867046-9867068 ATCAAGAAGAAGAAAGAGGATGG + Intergenic
1201075618 Y:10185180-10185202 TGGGAGAAGGGGAGAGAAGAGGG - Intergenic
1201361932 Y:13161430-13161452 TTGATGATGAGGAAAGCTGAAGG + Intergenic
1201467494 Y:14299547-14299569 CTGAAGAAAATAAAAGAAGATGG + Intergenic
1201470008 Y:14322726-14322748 AGGAAGGAAAGGAAAGAAGATGG - Intergenic
1201629211 Y:16050812-16050834 TTGATGAAGAGAAAAGCAGGTGG + Intergenic
1202193764 Y:22273904-22273926 TTTAAAATGAGGAAAGAAGGAGG - Intergenic
1202234110 Y:22690534-22690556 TTTAAAATGAGGAAAGGAGAAGG + Intergenic
1202309046 Y:23505624-23505646 TTTAAAATGAGGAAAGGAGAAGG - Intergenic
1202333511 Y:23780536-23780558 TTTGATAAGATGAAAGAAGAAGG - Intergenic
1202537258 Y:25889527-25889549 TTTGATAAGATGAAAGAAGAAGG + Intergenic
1202561755 Y:26164968-26164990 TTTAAAATGAGGAAAGGAGAAGG + Intergenic