ID: 1112206225

View in Genome Browser
Species Human (GRCh38)
Location 13:97325883-97325905
Sequence CAGTGGTGCTTGAAAGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 235}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112206225 Original CRISPR CAGTGGTGCTTGAAAGAAGA GGG Intronic
900737336 1:4307402-4307424 CAGTGTTGCTTCTAAAAAGAGGG - Intergenic
900766140 1:4506981-4507003 CAATGGAGCTTTAAAAAAGATGG + Intergenic
901002823 1:6157123-6157145 CAGGGCTGCTTGGAAGAAGTGGG - Intronic
902187368 1:14735422-14735444 CAGGGCTGCCTGGAAGAAGAAGG - Intronic
905174729 1:36128179-36128201 CAGGGCTGGTTGAAAGGAGAAGG - Intergenic
905491699 1:38349293-38349315 CAGTGGTTATTGTAAGAACATGG + Intergenic
905900847 1:41581228-41581250 CGGTGGGGCTTGAAATAAGGAGG + Exonic
906043567 1:42809085-42809107 CAGTGGTGATGGAAAGAAGATGG + Intronic
906808530 1:48803180-48803202 AAGAGCTGTTTGAAAGAAGAGGG - Intronic
906940711 1:50252782-50252804 AAGTTGTGCTGGAAAGAACAAGG + Intergenic
907770626 1:57459997-57460019 CAGTGGTGTTGCAAAGATGAGGG + Intronic
908637439 1:66183899-66183921 CAGTGGGTCTTGAATGAAGGGGG + Intronic
910664339 1:89708187-89708209 GAGTTGTCCTTGAAAGAAAATGG + Intronic
911226011 1:95306430-95306452 CAGGTGTTCTTGAAAAAAGAAGG + Intergenic
911321086 1:96414865-96414887 CAGTGGGAGTTGAAAGAATATGG + Intergenic
912654950 1:111477700-111477722 CCATGGTGCCAGAAAGAAGAGGG - Exonic
916299335 1:163256425-163256447 CAGTGGTGTTTGGAGGTAGAGGG + Intronic
916337741 1:163692464-163692486 CAGCAGGGCTTGAAAGAACATGG - Intergenic
916557130 1:165902900-165902922 AAATGTTGCTTGAAACAAGAAGG + Intronic
918319940 1:183354802-183354824 CTGTGGTGATTGAGAGAAGTAGG - Intronic
919232972 1:194799667-194799689 CAATGGTCCTTGCAAAAAGAAGG + Intergenic
919482856 1:198110697-198110719 CAGTGGTTCTTGGATGTAGAGGG - Intergenic
921279611 1:213552883-213552905 CAGTAGTGCTTGAAGGTAGAAGG - Intergenic
921973917 1:221180163-221180185 CTATGGTGTTTGAAAAAAGAAGG + Intergenic
922112601 1:222576287-222576309 CAGAGTATCTTGAAAGAAGAGGG + Intronic
923570328 1:235107704-235107726 CAGTGAGGCTGGAAAGAAGTGGG + Intergenic
1064453593 10:15466157-15466179 AAGTGCTGTTTTAAAGAAGATGG - Intergenic
1067411737 10:46070644-46070666 CAGTGGTGCTGAAAGGAAGCAGG + Intergenic
1069038533 10:63670500-63670522 CATTTGTGCCTGAAAGAGGAAGG - Intergenic
1070381226 10:75882150-75882172 GAGTGGTTGTTGAAGGAAGACGG + Intronic
1070647570 10:78212389-78212411 CAGTGGAGCTGGAGAGCAGAAGG - Intergenic
1071710278 10:88042946-88042968 CAGTGCTGCTTTCAAGAACAGGG - Intergenic
1072095125 10:92170861-92170883 TAGTGGTGGTTCAAAGAAGATGG - Intronic
1077955942 11:7020184-7020206 GAGCTGTGCTTGAAGGAAGAGGG - Exonic
1078340137 11:10492791-10492813 CAGTTGTGCTTGGAGGAACAAGG + Intronic
1078439135 11:11349880-11349902 AAGTGTTGATTGCAAGAAGAGGG - Intronic
1081620352 11:44615630-44615652 CAGTGTAGCTTGAGATAAGAGGG - Intronic
1083914712 11:65734066-65734088 CACTGGTGGATGAAAGAATAAGG + Intergenic
1084793615 11:71490272-71490294 CAGGGGTCCTTAAAAGAAGGGGG - Intronic
1086123067 11:83320578-83320600 CAGTGGTGGTTGGGAGAAGTGGG - Intergenic
1086886186 11:92208585-92208607 CATTGGTGTCTGTAAGAAGAAGG - Intergenic
1090894214 11:130955159-130955181 CTGTGGGGCCTGAAAGGAGAAGG + Intergenic
1090901979 11:131040099-131040121 CTGTGGTGCTTGCCAGAAGCTGG + Intergenic
1092725888 12:11485303-11485325 CACTGGTGTTTGAGAGAAGCCGG - Intronic
1092783077 12:12005213-12005235 AAGTGGGACTTGAAAGCAGAAGG - Intergenic
1094846227 12:34362572-34362594 CAGGAATGCTTGAAAGAGGAGGG - Intergenic
1094846913 12:34365387-34365409 CAGGAATGCTTGAAAGAGGAGGG - Intergenic
1095297754 12:40546382-40546404 CAGTAGTGCCTGAAATGAGAAGG - Exonic
1095298826 12:40558607-40558629 CAGTGGTGCCTGTAATAAGAGGG - Intronic
1097242920 12:57588542-57588564 CTGTTGTGTTTGAAAGAAGAGGG - Intergenic
1100161667 12:91867777-91867799 CAGTGGTTCTAGAATCAAGAAGG - Intergenic
1100265818 12:92974890-92974912 CTGTGAGGCTTGAAACAAGATGG + Intergenic
1100323252 12:93517145-93517167 CAGAGGTGCTCGAAAAATGATGG - Intergenic
1100596145 12:96073732-96073754 CCCTGGTGATTGACAGAAGAGGG - Intergenic
1101072384 12:101089417-101089439 AAGTGGAGATTGAAAGTAGATGG + Intronic
1102656508 12:114486356-114486378 CAGTGATACTTGCAAGAACATGG - Intergenic
1103014015 12:117480224-117480246 CAGGGGTGTTTGCAAAAAGATGG - Intronic
1104004586 12:124883033-124883055 CAGGGGTCCTTATAAGAAGAGGG + Intergenic
1106587740 13:31072012-31072034 CAGCGGTGCTGGAGAGAAGAGGG - Intergenic
1106733176 13:32562895-32562917 CATTGGTGTTTGAAGGAAGTAGG + Intergenic
1108475023 13:50807412-50807434 AACTGGTGCTTGAGAGAAGCAGG - Intronic
1108732782 13:53252279-53252301 CCCTGGTGCTTGAAAGAAAGTGG + Intergenic
1110139219 13:72106515-72106537 CAGTGGTAATTGAAAGATAATGG + Intergenic
1111278341 13:85983330-85983352 CAGTTGTTATTCAAAGAAGATGG - Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1111887388 13:94039448-94039470 TAGAGGTGACTGAAAGAAGAGGG + Intronic
1112206225 13:97325883-97325905 CAGTGGTGCTTGAAAGAAGAGGG + Intronic
1112400965 13:99077959-99077981 TAGTGGTTCTTGAATGAGGAAGG + Intronic
1113117150 13:106885698-106885720 CAGGAGTGCATGCAAGAAGAGGG - Intergenic
1113606038 13:111606895-111606917 CAGTTCTCATTGAAAGAAGAGGG - Intronic
1114038265 14:18650021-18650043 CAGACTTGCTTTAAAGAAGATGG - Intergenic
1114120357 14:19665021-19665043 CAGACTTGCTTTAAAGAAGATGG + Intergenic
1114234173 14:20810399-20810421 GAGTGGTGTTTGAAAGTTGAAGG + Intergenic
1114751845 14:25213122-25213144 CAGTGCTGCTTGAATGAGGAAGG - Intergenic
1114947975 14:27711056-27711078 CAGTAGAGATGGAAAGAAGAGGG - Intergenic
1115534648 14:34361732-34361754 CAGTGATGAATGAAACAAGAAGG - Intronic
1117077142 14:52116098-52116120 CAGTGGTTCTAGAGAGATGAGGG - Intergenic
1117219681 14:53590516-53590538 CAGTTGTGCCTGAAAATAGATGG + Intergenic
1117903754 14:60563225-60563247 CTGTGGTTCTTGACAGATGAAGG - Intergenic
1118675792 14:68183397-68183419 CAGTGTGGCTAGAAAGAAGCAGG - Intronic
1120347791 14:83312432-83312454 CAGTGGTTCAGTAAAGAAGATGG + Intergenic
1120678681 14:87453057-87453079 TACTGGTGCTTATAAGAAGATGG - Intergenic
1121303828 14:92892462-92892484 CTGTGGGGCTAGAAATAAGACGG - Intergenic
1126497238 15:49305508-49305530 CAGTGGCCCTTGACAGAATAAGG - Intronic
1128021422 15:64394094-64394116 CAGCAGTGCTTCAAAAAAGATGG + Exonic
1128536114 15:68491851-68491873 CAGGGGGGCTGGAAGGAAGAGGG + Intergenic
1137994183 16:53191430-53191452 CAGTGGTGGTTGAAAGAGGTAGG - Intronic
1138207727 16:55137147-55137169 TTGTGGTGGTTGAAAGATGAAGG + Intergenic
1138560994 16:57801116-57801138 CAGTGGTGGGTGAATGCAGAGGG + Intronic
1138612033 16:58132810-58132832 CAGTGCTGCTATAATGAAGATGG + Intergenic
1141241841 16:82272097-82272119 CAGTGGTTCTTGAAAGTACTGGG + Intergenic
1141761980 16:86034487-86034509 CTGAGGTCCTTAAAAGAAGAGGG + Intergenic
1144764832 17:17726615-17726637 CAGTGGTGAATGAATGAAAAGGG + Intronic
1146954859 17:36931587-36931609 TAGTACTGCCTGAAAGAAGAGGG + Intergenic
1147367245 17:39967034-39967056 AAGTAGTGGTTGAAAGAAGGAGG + Intronic
1147367399 17:39968151-39968173 AAGTAGTGGTTGAAAGAAGGAGG + Intronic
1147488597 17:40842552-40842574 CAGTGGTGCTTGGCAGGGGAGGG - Intergenic
1149636774 17:58177221-58177243 AAGAGGTGCTGGAAAGAAGGAGG + Intergenic
1151308383 17:73278717-73278739 GAGTGGTGCTTGCAGGCAGATGG - Intergenic
1153748236 18:8202347-8202369 AAGTGGTGCTAGAAAGAAGAGGG + Intronic
1154286488 18:13062054-13062076 CAGTGGTGTTTGGTAGTAGAAGG + Intronic
1155627100 18:27846905-27846927 CAGTGGTGATGGACAGAAGTGGG - Intergenic
1156537267 18:37876203-37876225 CAGAGGTTCTGGAAAGATGATGG + Intergenic
1158551810 18:58442560-58442582 CAGTGGGGCTGGAAGGAAGCTGG - Intergenic
1158945777 18:62445936-62445958 TAGTGTTGCTTGGAAGAAGTAGG + Intergenic
1160330423 18:77986582-77986604 CAGTGGTCCTTGTTTGAAGAAGG + Intergenic
1160850547 19:1189568-1189590 CACTGGTGCCTGGAGGAAGAGGG - Intronic
1161821246 19:6532182-6532204 CAAGGGGGCTGGAAAGAAGAGGG + Intronic
1165924094 19:39316450-39316472 CGGTGGTACATGAATGAAGATGG - Intergenic
1166297706 19:41897064-41897086 CAGGGGGGCTTGAAAGAGAAGGG - Intronic
1168173502 19:54606901-54606923 CAGGAGTGTTTGAAAGAAGACGG + Intronic
925670187 2:6302785-6302807 CATTGGTCCTTGAAAGCAGGTGG - Intergenic
929593827 2:43163249-43163271 CAGTGGTGTTTGATAAAAGGCGG - Intergenic
930936128 2:56954242-56954264 CAATGGTCCTTAAAAGTAGAAGG - Intergenic
933583843 2:84158936-84158958 CCATGGTGCATAAAAGAAGACGG - Intergenic
934688439 2:96338595-96338617 CAGTGGTCCTTGTAAGAGGAAGG + Intronic
935397641 2:102624668-102624690 CAGTGACACTTGAAAGGAGATGG - Intronic
936616406 2:114052191-114052213 CAGTGGTAATTGAAATAGGAGGG - Intergenic
937048841 2:118871609-118871631 CAGAGGAGCTGGAAAGAAGTAGG - Intergenic
937261786 2:120591334-120591356 TGGTGGTGCTGGAAACAAGATGG - Intergenic
937308543 2:120887120-120887142 CTGTGGTCCTTGAAAGCAGATGG + Intronic
938272695 2:129989079-129989101 CAGACTTGCTTTAAAGAAGATGG + Intergenic
938443539 2:131357035-131357057 CAGACTTGCTTTAAAGAAGATGG - Intergenic
939618476 2:144388640-144388662 CATGGGTGCTTCAAAGAACAGGG + Exonic
939752755 2:146067838-146067860 CTGTGGTCCTTGAGAGAAGGAGG + Intergenic
940671544 2:156675532-156675554 TAATAGTGCTTGAAGGAAGAAGG + Intergenic
940971568 2:159902330-159902352 CAGTGGTGTTTGAGAGAAAATGG + Intronic
941171503 2:162142816-162142838 CAGGGGTGCTTGGAAGGAGTGGG + Intergenic
942808710 2:179969452-179969474 CAGTAGTGCTTAGAAGTAGAAGG - Intronic
943458109 2:188133045-188133067 CAGTGGAACTGGGAAGAAGATGG + Intergenic
944301683 2:198131052-198131074 GAGTAGTGCATGGAAGAAGAAGG - Intronic
944656950 2:201885006-201885028 GAGTGGGCCTTGAAAGATGATGG + Intronic
945997540 2:216450744-216450766 CAGGGGTGGTTGTGAGAAGAGGG + Intronic
946007678 2:216539431-216539453 CTGGTGTCCTTGAAAGAAGAGGG - Intronic
948059607 2:235033152-235033174 CTGTGGTGCTTGAATGCAGCAGG - Intronic
1170729480 20:18960739-18960761 AATTGGTGCTTTTAAGAAGATGG + Intergenic
1170795887 20:19546456-19546478 CAGAGCTGCTTGACAGAAGTGGG + Intronic
1173375569 20:42479543-42479565 CGATGATGCTGGAAAGAAGATGG - Intronic
1174542698 20:51302518-51302540 CTGTGGGGCTTGGAAGAGGAGGG + Intergenic
1175164455 20:57033403-57033425 CAGTGGGGCTGGAGAGAAGGGGG + Intergenic
1175444512 20:59010752-59010774 CAGTGGTGCTTGAGGGCAGAGGG + Intergenic
1175749725 20:61486983-61487005 CAGTGGTGCCTGGCAGAGGAAGG + Intronic
1176303506 21:5111260-5111282 CACGGGTGCTTGGAAGAAGCAGG + Intergenic
1177249852 21:18578730-18578752 CTCTGGTTCTTGAAAGAATATGG + Intergenic
1178757128 21:35362682-35362704 CAATGATGATTGGAAGAAGAAGG - Intronic
1181972174 22:26699170-26699192 CAGTGGTGCTTGAAAAATGGTGG + Intergenic
1182917395 22:34047714-34047736 CAGTGGTGATTGAGATGAGACGG - Intergenic
1183182948 22:36273429-36273451 CAGAGGTTCTTGAAAGAGTACGG - Intergenic
1184431727 22:44445036-44445058 TAGTGGGGCCTGGAAGAAGAGGG + Intergenic
1185415285 22:50706057-50706079 CGGTGGGGCTGCAAAGAAGAGGG - Intergenic
949600100 3:5588889-5588911 GAGTGGTGCTGGAAAGGAAAGGG - Intergenic
951632429 3:24736468-24736490 CAGTAGTAGTTGGAAGAAGAGGG + Intergenic
953262378 3:41352347-41352369 CAGTGGTGCCTTAAAGATAAAGG - Intronic
954305816 3:49724809-49724831 GGGTGGTGCTTAAAAGAGGAAGG - Exonic
954343597 3:49976338-49976360 TTTTGGTGCTTGAAAGAATATGG + Intronic
956585971 3:70865404-70865426 CAAGGGTTCTTGCAAGAAGAAGG - Intergenic
957228075 3:77474470-77474492 CAGTTGTGTTTTAAAGAAAAAGG - Intronic
957705827 3:83782067-83782089 CAGTGGTGTTTTATAGAAGTTGG - Intergenic
958728299 3:97932838-97932860 CAGTGGATCTGGAAAGAAGATGG - Intronic
958986229 3:100782509-100782531 CAGTGGTGCCTGAAAGCATTGGG + Intronic
959384139 3:105680658-105680680 CAGTGGTACTTGTGAGAAAATGG + Intronic
961352535 3:126313128-126313150 CTGGGGTGCTTGTAAGAAGAGGG + Intergenic
961535033 3:127565442-127565464 CAGTGTGGATTGAAATAAGACGG - Intergenic
962562811 3:136625254-136625276 CAGTTGAGCTTTAAGGAAGAGGG - Intronic
962671041 3:137708931-137708953 CAGGGGTGTTGGAAAGAGGATGG + Intergenic
963249434 3:143089449-143089471 CAGTGCTGCTTTAAAAAAGCCGG + Intergenic
964233352 3:154496304-154496326 AAGTGGTTCTTGAAAGGAGATGG + Intergenic
964431227 3:156608292-156608314 CAGCAGTGCTGGAAAGAATATGG - Intergenic
965272514 3:166637175-166637197 CAATGGTGCTTGCAATGAGACGG - Intergenic
969933164 4:10653175-10653197 CAGTGGGGCTTGTCAGGAGATGG + Intronic
971062300 4:22985914-22985936 GAGTGGGGTTTGAAATAAGATGG + Intergenic
971662898 4:29443002-29443024 ATGAGGTACTTGAAAGAAGAGGG + Intergenic
974122544 4:57657234-57657256 CAGAGATGTTTGAAAGCAGATGG + Intergenic
974612214 4:64231182-64231204 CAATGGTACTTAAATGAAGAGGG - Intergenic
975271876 4:72445019-72445041 CAGTGGTTTCTGAAAGGAGAGGG + Intronic
976662766 4:87557275-87557297 TAATGGAACTTGAAAGAAGAAGG + Intergenic
977289541 4:95149149-95149171 CAGTGATGCTTGAAAAAGCAGGG - Intronic
977316392 4:95453980-95454002 CATTGGTGGTTGCCAGAAGAAGG + Intronic
977380264 4:96263971-96263993 AAGTGGTTCTTGGGAGAAGAAGG + Intergenic
977858525 4:101926688-101926710 AAGTGGTGCGTAAAAGGAGATGG + Intronic
979006745 4:115308793-115308815 CAGTGGTTCTTGAAACAAGGAGG - Intergenic
979776065 4:124589865-124589887 CAGTCATGTTTGAAACAAGATGG - Intergenic
980389956 4:132131688-132131710 CAGTGAGGATAGAAAGAAGATGG + Intergenic
981107966 4:140902968-140902990 CAGTGGTGCTAGAAGGAGAAAGG + Intronic
982020569 4:151199612-151199634 CAGTGTGGCAGGAAAGAAGAGGG - Intronic
982693954 4:158579060-158579082 CAGAGATGCTGGAGAGAAGAGGG + Intronic
983630661 4:169846020-169846042 CAGTGATGCTTGAACTAACATGG - Intergenic
985088448 4:186339518-186339540 CATGGGAGCATGAAAGAAGAGGG - Intergenic
985513722 5:326356-326378 CTGTGATGCGTGAAAGAAGCTGG - Intronic
986137231 5:4992095-4992117 ATGTGGGTCTTGAAAGAAGAGGG - Intergenic
986598925 5:9451820-9451842 CAGCCGTGCAGGAAAGAAGACGG - Intronic
987331787 5:16863438-16863460 CAGTGGTGCTGGGAACAAGGTGG + Intronic
988008779 5:25455189-25455211 CAGTGCTTCTGGATAGAAGATGG - Intergenic
988406488 5:30829956-30829978 CATTTGTGCTTGAAAGTAAATGG - Intergenic
988790698 5:34604775-34604797 CAGGGTTGCTTTAAGGAAGACGG + Intergenic
988850363 5:35174522-35174544 CAGTGTTGTTTGAAAGAGAAAGG - Intronic
989187617 5:38640408-38640430 GGGTGGGGCTTGAGAGAAGAAGG - Intergenic
992125133 5:73632123-73632145 CAGTGGTGCTGCAAACAAGAAGG - Intronic
992127350 5:73655492-73655514 CAGTGGGGTTTGTAAGAAGAGGG + Intronic
992162973 5:74020460-74020482 CAGTGGTGACAGAAAGAAAATGG + Intergenic
996516325 5:124373404-124373426 GAGTGGTAATAGAAAGAAGATGG - Intergenic
999610842 5:153367841-153367863 CTATGGAACTTGAAAGAAGAAGG - Intergenic
999634079 5:153601902-153601924 CAGGGCTGCTAGAAAGGAGAAGG + Intronic
1003166050 6:3679514-3679536 CAGTGGTGCCTAAGAGAAAATGG + Intergenic
1003325662 6:5087966-5087988 CACTGTTGCTTGATAGAACAGGG + Exonic
1003676907 6:8213125-8213147 CAGTGGTGTTTAAAGGAATATGG + Intergenic
1003891052 6:10564101-10564123 CAGAGGTGCAGGAAAGATGAAGG + Intronic
1006076074 6:31533327-31533349 CAGAGGTGCTTCTAAGAACATGG + Intronic
1006701937 6:35981972-35981994 CAGAGGTTCATGAAAGGAGAAGG - Intronic
1007254706 6:40520664-40520686 CAGTGGTGCCAGCAAGGAGAGGG + Intronic
1007389874 6:41545089-41545111 CAGTGGTCCTTGAAAGAAAAGGG - Intergenic
1007498242 6:42276577-42276599 CAACGGTGCTAAAAAGAAGACGG - Intronic
1011937680 6:92801414-92801436 CATTGGTGCTTGAGAAATGAGGG - Intergenic
1012977699 6:105797727-105797749 CAGTGTTGCTTCAAAGTAGGAGG - Intergenic
1013003236 6:106046070-106046092 CAGAGCTGCTTTAGAGAAGAAGG + Intergenic
1013148385 6:107418235-107418257 CAGGGGTGCTCAAAAGAGGAAGG + Intronic
1013798258 6:113909401-113909423 CGGTGGTCCTTGAAACACGATGG + Intergenic
1014009587 6:116460922-116460944 GAGGTGTGCTTGAAAGAACATGG - Intergenic
1015173751 6:130283299-130283321 AGGTGGTGTTTGAGAGAAGAGGG + Intronic
1015612959 6:135045505-135045527 CAGTGGTGCTGGAATGAAGCAGG + Intronic
1015859953 6:137665492-137665514 CAGTAATCCTTCAAAGAAGAAGG + Intergenic
1018813696 6:167316245-167316267 CAGTGCTGCTAGGAAGAACAAGG - Intergenic
1020654394 7:10912171-10912193 CAGTGGAGGTGGAGAGAAGAGGG - Intergenic
1022786801 7:33646127-33646149 CAGTGATGATGGAAAGGAGAAGG - Intergenic
1022825942 7:34013959-34013981 AAGTGGTGAGGGAAAGAAGATGG - Intronic
1023712952 7:43014113-43014135 CAGTGGTGATTGAAAGGATATGG - Intergenic
1028642032 7:93053252-93053274 CAGTCTTGTTTGAAAGAAGCAGG + Intergenic
1030412127 7:109193712-109193734 CAGTCATGGTGGAAAGAAGAAGG + Intergenic
1030424830 7:109362268-109362290 CAGTTTTGCTTGAAAGTAAAAGG - Intergenic
1030977032 7:116139429-116139451 CAGTGGCTCTTGAACGGAGAAGG - Intronic
1032762712 7:134959308-134959330 CAGTCGTGCTCAAAACAAGACGG - Intronic
1033440192 7:141371553-141371575 AAGTGGGGCTAGAAGGAAGAAGG + Intronic
1035283953 7:157794456-157794478 CAGTGAAGCTTCAAAGAATAGGG - Intronic
1035386768 7:158478174-158478196 AGGTGCTGCTTGAATGAAGAAGG + Intronic
1035477563 7:159154046-159154068 CAGTGGACCTTGAACGAAGAGGG - Intergenic
1038688444 8:29739777-29739799 CAGTGGGGGTTGAAGGAAGAGGG + Intergenic
1040027142 8:42792236-42792258 GAGTGGTGCAGCAAAGAAGAAGG - Intronic
1040981279 8:53248433-53248455 TAGCTGTGCTTGAAAGATGAAGG - Intronic
1043550428 8:81365681-81365703 CACTGGTGCTTGCAAGAGGGTGG - Intergenic
1043951111 8:86310112-86310134 CAGTGGTGCTAGAACAAAGCAGG + Intronic
1043951879 8:86318458-86318480 AAGTGGTGGTTGAAAAAAGAAGG + Intronic
1044021660 8:87112624-87112646 CATTGGTGTTTGAAAGATAAGGG - Intronic
1045723837 8:105147064-105147086 AAGTTGTGCTTGAAAAAAAAGGG + Intronic
1050823119 9:9908158-9908180 CCATGGAGATTGAAAGAAGATGG + Intronic
1052427010 9:28318086-28318108 CAGTGAACCTTGAAAGAACATGG - Intronic
1055157176 9:73078751-73078773 CAGAGGTACTTGACAGAAAATGG + Intronic
1057830936 9:98406463-98406485 CTGGGGTGCTGGAAAGATGACGG + Intronic
1058163377 9:101594385-101594407 GGGTGGTGCTTGTAAGAAAAAGG + Exonic
1059957426 9:119532844-119532866 TAGGGGTGCTAGAAAGAAAATGG - Intergenic
1060803855 9:126562810-126562832 CAGTGGAGCTTGAAGGCTGAGGG - Intergenic
1061964305 9:134004499-134004521 CACTGGTGTTTGAGAGAAGCGGG - Intergenic
1185458634 X:323278-323300 CAGTGGTGTTAGAAATAATAGGG - Intergenic
1186459918 X:9739929-9739951 CAAGGGTGCCTGAAAGCAGAGGG + Intronic
1186688827 X:11953209-11953231 TAGAGCTGCTTGAAGGAAGAAGG - Intergenic
1187085410 X:16037538-16037560 CAGTTGTGCTTGGAAGGAGAAGG - Intergenic
1187259723 X:17674038-17674060 CAGAGGTGCTTTAAAGAGAAAGG - Intronic
1187866713 X:23729420-23729442 CAGTGGTCCTTCATAGCAGAAGG - Intronic
1188675033 X:32929087-32929109 CAGTGGTGCTTAATAGAAAGGGG + Intronic
1192625840 X:72727590-72727612 CAGAAGTGCTTGAAAGGATAGGG + Intergenic
1193407678 X:81122201-81122223 CTGTGGTGCTGGCAAGAGGAGGG + Intronic
1196260754 X:113577889-113577911 CAGTGGAGGCTGGAAGAAGAAGG + Intergenic
1196897706 X:120353904-120353926 CAGAGGTGGTGGAAAGAAAATGG + Intergenic
1199535865 X:148902552-148902574 AAGTGGTGCTGGCAAGAAGTGGG - Intronic
1200123698 X:153803358-153803380 CGGTGGTGACTGAGAGAAGAGGG + Exonic