ID: 1112208293

View in Genome Browser
Species Human (GRCh38)
Location 13:97347251-97347273
Sequence GATTTACTTATTGTGCTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 168}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112208293_1112208301 2 Left 1112208293 13:97347251-97347273 CCCTTCAGCACAATAAGTAAATC 0: 1
1: 0
2: 0
3: 8
4: 168
Right 1112208301 13:97347276-97347298 TCAGGTGCAGGGAAAGTCCTGGG 0: 1
1: 0
2: 2
3: 17
4: 238
1112208293_1112208297 -9 Left 1112208293 13:97347251-97347273 CCCTTCAGCACAATAAGTAAATC 0: 1
1: 0
2: 0
3: 8
4: 168
Right 1112208297 13:97347265-97347287 AAGTAAATCCCTCAGGTGCAGGG 0: 1
1: 0
2: 0
3: 18
4: 140
1112208293_1112208296 -10 Left 1112208293 13:97347251-97347273 CCCTTCAGCACAATAAGTAAATC 0: 1
1: 0
2: 0
3: 8
4: 168
Right 1112208296 13:97347264-97347286 TAAGTAAATCCCTCAGGTGCAGG 0: 1
1: 0
2: 1
3: 5
4: 125
1112208293_1112208306 30 Left 1112208293 13:97347251-97347273 CCCTTCAGCACAATAAGTAAATC 0: 1
1: 0
2: 0
3: 8
4: 168
Right 1112208306 13:97347304-97347326 TGAGCTCCGTTCCCCCTCCTAGG 0: 1
1: 0
2: 0
3: 15
4: 144
1112208293_1112208302 3 Left 1112208293 13:97347251-97347273 CCCTTCAGCACAATAAGTAAATC 0: 1
1: 0
2: 0
3: 8
4: 168
Right 1112208302 13:97347277-97347299 CAGGTGCAGGGAAAGTCCTGGGG 0: 1
1: 0
2: 1
3: 19
4: 319
1112208293_1112208300 1 Left 1112208293 13:97347251-97347273 CCCTTCAGCACAATAAGTAAATC 0: 1
1: 0
2: 0
3: 8
4: 168
Right 1112208300 13:97347275-97347297 CTCAGGTGCAGGGAAAGTCCTGG 0: 1
1: 0
2: 0
3: 23
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112208293 Original CRISPR GATTTACTTATTGTGCTGAA GGG (reversed) Intronic
903317713 1:22521620-22521642 GATGTGCTTCTTGTGCTCAATGG - Exonic
903751987 1:25629139-25629161 GATCTACTTATAGTTCTTAAAGG + Intronic
905264977 1:36745996-36746018 GATTTACTTTTAGTTCTGTAAGG - Intergenic
907194312 1:52674164-52674186 GATTAAATTATTGTGAAGAATGG - Intergenic
908261518 1:62342929-62342951 GATTTTCTTATTGTTCTTCATGG - Intergenic
909785766 1:79610805-79610827 GATTTATTTATATTTCTGAATGG + Intergenic
910281604 1:85507494-85507516 TATTTATTTATTGTGATGCAGGG - Intronic
912224803 1:107721246-107721268 ACTTTAATTATTCTGCTGAATGG - Intronic
914386648 1:147175654-147175676 AATTTACTTATAGTTCTGCATGG - Intronic
914735138 1:150409170-150409192 GCTTTAATTATTATGCAGAAGGG - Intronic
914909764 1:151775482-151775504 GACTCACTCATTGTGCTGACTGG - Exonic
915844157 1:159246280-159246302 GATATATTTAAAGTGCTGAAGGG - Intergenic
915855696 1:159384095-159384117 GATTTAATGACTGTGCTGATGGG + Intergenic
918133895 1:181653159-181653181 CATTTTCTTATAGTTCTGAAGGG + Intronic
918992306 1:191712924-191712946 CATTTCCTTATTGTGCTAAGTGG + Intergenic
919431103 1:197492794-197492816 TATTTATTTATTTTGCTGATTGG - Intergenic
921325727 1:213985057-213985079 CATTTACTTATTTATCTGAAGGG - Intronic
923965833 1:239137998-239138020 AATTTGCTTATTTTGGTGAAGGG - Intergenic
1062775709 10:145441-145463 GATTTACTTTTAGTACTTAAAGG + Intronic
1068035015 10:51748354-51748376 AATATACTAATGGTGCTGAAGGG + Intronic
1068292155 10:55017228-55017250 GATTTCTGCATTGTGCTGAATGG - Intronic
1068348107 10:55810642-55810664 GATTTGCTTATTGTGAAAAAGGG + Intergenic
1068583407 10:58768299-58768321 GATATACTCAAAGTGCTGAAAGG + Intronic
1070341277 10:75500628-75500650 GATTGACTTATAGTTCTGCATGG + Intronic
1070859701 10:79642660-79642682 GATTTGCTTATTGTGAAAAAGGG - Intergenic
1072818591 10:98534022-98534044 AAATTTCTTATTGTCCTGAAAGG - Intronic
1076611938 10:131731565-131731587 GAGTTGCTGATTGTGCTGAGTGG - Intergenic
1082194974 11:49292985-49293007 GGTTGGCTTATTGTGCTGACTGG + Intergenic
1085909173 11:80800985-80801007 GATTTACTGATTTTTTTGAAGGG - Intergenic
1086740200 11:90358303-90358325 GATTTGCTCTTTGTGCTGTAAGG - Intergenic
1090565560 11:127988343-127988365 GATATATTCATTGTGCAGAATGG + Intergenic
1092800439 12:12159943-12159965 GATTTATGTATTGGACTGAATGG - Exonic
1092980964 12:13793791-13793813 GACTTACTGATTGTGCTCAGAGG - Intronic
1093418080 12:18943630-18943652 GATTTACTTTTAGTGCCCAATGG - Intergenic
1094348928 12:29501381-29501403 GAGTTACTCATTGAGCTTAATGG + Intronic
1096023440 12:48341086-48341108 GATAGACTTATTTTGCTGACTGG - Exonic
1098896298 12:76065188-76065210 TATTTACTTAATATACTGAAGGG + Intronic
1098902390 12:76126181-76126203 TATTTTCTTATTTTGATGAACGG - Intergenic
1101368626 12:104102076-104102098 AATTCACTGATTTTGCTGAAAGG - Exonic
1106416287 13:29548696-29548718 GATTAAAATATTGTGCTGTAAGG - Intronic
1106816270 13:33410667-33410689 GATGAAATTATTGTGTTGAAAGG - Intergenic
1108949959 13:56079293-56079315 GTTTTATTTATTCTGCTTAAAGG - Intergenic
1111280858 13:86022405-86022427 GATTTACTTTCACTGCTGAAAGG - Intergenic
1112072030 13:95863750-95863772 GCTTTAAATATTGTGCTGTATGG + Intronic
1112208293 13:97347251-97347273 GATTTACTTATTGTGCTGAAGGG - Intronic
1113299048 13:108996609-108996631 CATTTCCTTATTGTCCTCAAAGG - Intronic
1115657133 14:35454099-35454121 AATTTAATTATCCTGCTGAATGG + Intergenic
1116380291 14:44259337-44259359 GACTTTCTGATTCTGCTGAAAGG - Intergenic
1116724281 14:48542854-48542876 GATGTATATATTGTGCTTAATGG - Intergenic
1117158088 14:52960693-52960715 GCTTGAGTTATTGTGCTGATCGG + Intergenic
1118022070 14:61727634-61727656 AATTTTCTTATTGTGATGAAAGG + Exonic
1124069056 15:26374343-26374365 AATTTAGTTTTTGAGCTGAAGGG - Intergenic
1126080704 15:44958295-44958317 GATTTATTTATTCTTTTGAAAGG + Intronic
1127590230 15:60415315-60415337 TTTTTCCTTATTGTGCTGAGAGG - Intergenic
1127665692 15:61144579-61144601 GATTTACATTTTGTTATGAATGG - Intronic
1127936428 15:63644045-63644067 GGTTTACTCTTTGTGCTGGAGGG - Intronic
1128817612 15:70625020-70625042 GTTTTCCTTATTGTGCTAATGGG + Intergenic
1131583165 15:93665101-93665123 GAATTTATTATTCTGCTGAAAGG + Intergenic
1137973512 16:53010116-53010138 GATATATTTAAAGTGCTGAAAGG - Intergenic
1141060196 16:80859875-80859897 GATTGAGTAATTGTACTGAAGGG - Intergenic
1148674945 17:49439667-49439689 AATCTCCTGATTGTGCTGAAGGG + Intronic
1153405866 18:4738591-4738613 GGTTTACTGAATGTGCTTAACGG - Intergenic
1154321005 18:13352399-13352421 GATTTATTTAAACTGCTGAAAGG - Intronic
1155857037 18:30847218-30847240 GATTTACTGATTTTTTTGAAGGG + Intergenic
1156243428 18:35274797-35274819 GATTTACTGGTTGTCCTTAAGGG + Intronic
1158076056 18:53531160-53531182 TATTTACTTTTTGTGCTGTAAGG - Exonic
1158216823 18:55109366-55109388 GATATACTTCTGGGGCTGAATGG + Intergenic
1158670449 18:59469311-59469333 GTTTTAGTAATTGTGATGAAGGG + Intronic
1162865518 19:13543227-13543249 GGTTTGCTTTTGGTGCTGAAGGG - Intronic
1165290021 19:34875566-34875588 GATGTACATATTATACTGAAAGG + Intergenic
926512295 2:13797492-13797514 GACATACTTAAAGTGCTGAAGGG - Intergenic
927802097 2:26110414-26110436 AATTTACTAATTGTCTTGAATGG - Intronic
928171641 2:29008069-29008091 GATTTGCTTATTTTGTTTAATGG - Intronic
933283653 2:80360121-80360143 AATTTTCTTATTGTTTTGAAGGG + Intronic
933896796 2:86818341-86818363 TATTTTTTTATTGTGCTGCACGG + Intronic
934978174 2:98820756-98820778 CATTTACTTGCTGTCCTGAAAGG - Intronic
939432203 2:142125263-142125285 AGCTTACTTGTTGTGCTGAATGG + Intronic
939940726 2:148347807-148347829 GTTTTATTTTTTATGCTGAAAGG + Intronic
941013004 2:160322644-160322666 GATTTACCTAAGGTGCTGAAGGG + Intronic
941503290 2:166308548-166308570 AATTTACTCACTGTTCTGAATGG - Intronic
942750876 2:179285707-179285729 GATTATCTTATTATGCAGAACGG - Intergenic
945463059 2:210134070-210134092 GATATATTTAAAGTGCTGAAAGG - Intronic
946512542 2:220374696-220374718 GATTTAATTAATGTACTGACTGG - Intergenic
947130838 2:226923315-226923337 GATATATTTAAAGTGCTGAAGGG - Intronic
1169787914 20:9380322-9380344 GATTGACTAATTCTGATGAAAGG - Intronic
1170791090 20:19510153-19510175 GATTTACATTCTGTGCTGCAGGG + Intronic
1170903216 20:20486396-20486418 AATATATTTATTGTGTTGAAAGG - Intronic
1172370008 20:34381968-34381990 GATTTACTGATTGTCCAGTAAGG - Intronic
1174938793 20:54900946-54900968 GATTTACTGATTTTTTTGAAGGG - Intergenic
1177262877 21:18752068-18752090 GTTTTACCTATTGTGCTCGATGG - Intergenic
1177718538 21:24873134-24873156 TATTTATTTAATGTGCTGAAAGG + Intergenic
1177973321 21:27817238-27817260 CATTTACTTATACTGTTGAAAGG - Intergenic
1178350732 21:31871839-31871861 GTTTTTCTTGCTGTGCTGAAGGG - Intergenic
1182882556 22:33746060-33746082 GATATTCTTATTGTGCAGATGGG - Intronic
953305735 3:41827344-41827366 GATTCACTGATTGTTTTGAAGGG - Intronic
957932566 3:86900041-86900063 GATTTGCATATTTTGGTGAATGG - Intergenic
958478200 3:94612574-94612596 GACTGCCTTATTTTGCTGAAAGG - Intergenic
959442810 3:106399481-106399503 CATTTACTTCTTGTGCTAAATGG + Intergenic
961262144 3:125610684-125610706 GAATTCCTTATTATGCTGACTGG + Intergenic
962598763 3:136974443-136974465 GATATATTTAAAGTGCTGAAAGG - Intronic
963446119 3:145410371-145410393 GATTCACTTTTTGTGTTGTATGG + Intergenic
964544297 3:157816564-157816586 GATCTACTTATGATGTTGAATGG - Intergenic
972190189 4:36581747-36581769 GCTTTAGTTAATGTGCTGATTGG + Intergenic
973073299 4:45892903-45892925 GATTTACTTATTTTATTAAATGG + Intergenic
973234298 4:47881999-47882021 GATTTACTTTCTGTGTTGTATGG - Intronic
973703812 4:53562301-53562323 GATGGACTTATTGAGTTGAATGG - Intronic
976658305 4:87512272-87512294 GATTTCCCTTCTGTGCTGAAGGG + Intronic
980276666 4:130661105-130661127 TATTTCCTTATTGTAATGAAAGG - Intergenic
981202383 4:141995819-141995841 GATTTATTGATTGAACTGAATGG - Intergenic
982217834 4:153097512-153097534 GAGTTACATATGTTGCTGAAGGG - Intergenic
984013541 4:174400447-174400469 GATTTACTTATCTTGGTGAATGG - Intergenic
984403638 4:179299377-179299399 GTTATACTTATTTTTCTGAATGG - Intergenic
986398866 5:7359410-7359432 TATATACTTATTCTGATGAATGG - Intergenic
988341179 5:29973783-29973805 GATGTATTTAATGTGCTGATGGG + Intergenic
988875502 5:35441257-35441279 GGTTTACTCCTTGTGCTGGAAGG - Intergenic
989636117 5:43536163-43536185 GATGTACTCATTCTGCTGATGGG + Intronic
991105137 5:62834574-62834596 GATTTATTTAAAGTTCTGAAAGG - Intergenic
994473844 5:100242132-100242154 TATTTACTTATTGTGTATAAGGG + Intergenic
995825105 5:116288244-116288266 GATATACTCAAAGTGCTGAAAGG - Intronic
996772179 5:127097433-127097455 TGTTTACTTTTTGTGCTGATTGG - Intergenic
999605613 5:153311495-153311517 GATTTGTTTATGGTGCAGAATGG - Intergenic
1000502794 5:162073113-162073135 GATTTATTCAGTGGGCTGAATGG - Intronic
1000923806 5:167169697-167169719 AATTTATTTATTGTGATAAAGGG - Intergenic
1002936854 6:1681473-1681495 GATTTCCATCTTGTCCTGAATGG - Intronic
1003979373 6:11375789-11375811 GATTGACTTATGGTTCTGCAGGG - Intronic
1005207600 6:23422039-23422061 GAATTGTTTATAGTGCTGAATGG + Intergenic
1006484242 6:34325093-34325115 GATTTACTTAAGGGCCTGAAAGG + Intronic
1008278160 6:49564957-49564979 GATTTCTTTATGGTGCTGATAGG + Intergenic
1009792034 6:68415979-68416001 GAATTACTTTTTGTCCAGAAAGG + Intergenic
1010227269 6:73502487-73502509 AATTTCATTATTTTGCTGAACGG - Intronic
1010663640 6:78600285-78600307 AAATTAGTTATTTTGCTGAAGGG + Intergenic
1012933067 6:105337339-105337361 GATTTAATTATAGTGCTGTCAGG - Intronic
1015130129 6:129800162-129800184 GATTTCCTTATTGTACTTGATGG + Intergenic
1015380576 6:132562789-132562811 GATTTATTTATTGTACCCAAAGG + Intergenic
1015710683 6:136136404-136136426 GACTTTCTTATTATGCTGTAAGG - Intronic
1016541691 6:145172498-145172520 GACATACTTAAAGTGCTGAAGGG + Intergenic
1017396385 6:154003847-154003869 GACATATTTATTATGCTGAAGGG + Intergenic
1021651095 7:22834166-22834188 GTTTTCTTTATTTTGCTGAAAGG + Intergenic
1022549490 7:31225293-31225315 GATATACTCAAAGTGCTGAAAGG - Intergenic
1023142647 7:37117561-37117583 GATTTACTAATTGAGCTGGAAGG - Intronic
1025641820 7:63380594-63380616 AATTTACTTCTTGTCCTGGAAGG + Intergenic
1027922346 7:84410602-84410624 GCTTGACATATTCTGCTGAAAGG - Intronic
1028122458 7:87071448-87071470 GACTTACTTATTGTGCCGGCTGG - Intergenic
1031083503 7:117280283-117280305 AATTTACTGATTATGCAGAAAGG + Intronic
1032906127 7:136369255-136369277 GATGTACTTATTCTGTTTAAAGG + Intergenic
1033399608 7:141009528-141009550 GATTTACGTATTATCCTTAAAGG + Intronic
1033806056 7:144955348-144955370 GAATTACTTAATTTGATGAAGGG + Intergenic
1035237124 7:157505373-157505395 GATGGACTTATTTTGCTGCAAGG - Intergenic
1038133590 8:24760791-24760813 GATTTATTCAAAGTGCTGAAAGG + Intergenic
1039174773 8:34791204-34791226 GATTTCCTTATAGGGCTTAAAGG - Intergenic
1039755212 8:40515480-40515502 AATTTGCTTATTGTACTGAGAGG - Intergenic
1041600701 8:59714210-59714232 TGTTTTCTAATTGTGCTGAAAGG + Intergenic
1041616277 8:59910489-59910511 GACATATTTAATGTGCTGAAGGG - Intergenic
1042838233 8:73097142-73097164 AACTTACTTGTTTTGCTGAAGGG + Intronic
1043012642 8:74900294-74900316 GACTTTCTTATTATCCTGAATGG - Intergenic
1043822539 8:84885970-84885992 GAATGACTTAATGTGCTTAAAGG + Intronic
1044559576 8:93599590-93599612 GATTTGCTTCTAGAGCTGAATGG - Intergenic
1045813736 8:106255249-106255271 GATTTACTTTTAGTGCTTTAAGG + Intergenic
1047936110 8:129780486-129780508 GACATATTTAATGTGCTGAAGGG + Intronic
1048605721 8:135966764-135966786 GCTTTACTCAATGTGCTGATTGG - Intergenic
1050713933 9:8498825-8498847 GTTTTACATATTTTCCTGAAAGG - Intronic
1051729033 9:20119748-20119770 GATTTCCTTATTGCACTGTATGG - Intergenic
1060073176 9:120568525-120568547 GATTTACTGATTTTGCTCCAGGG + Intronic
1186580910 X:10817327-10817349 GATTTGTTTGTTTTGCTGAAAGG - Intronic
1186991404 X:15073166-15073188 GAACTACTTAATTTGCTGAAGGG + Intergenic
1191209111 X:57866325-57866347 GATTCACTGATTGTTTTGAAGGG - Intergenic
1193903071 X:87206816-87206838 GATATATTTAAAGTGCTGAAGGG + Intergenic
1194162914 X:90477284-90477306 TATTTATTTATTGTGAAGAAGGG - Intergenic
1194674113 X:96773169-96773191 GATTTTCTTATTGTGTGGAGTGG + Intronic
1196402595 X:115331835-115331857 AATTTATATATTTTGCTGAATGG - Intergenic
1196538774 X:116880947-116880969 GACGCACTTAATGTGCTGAAGGG - Intergenic
1197375682 X:125679356-125679378 CATTTACTTATTGTGCAAAATGG - Intergenic
1197674465 X:129314542-129314564 GATTCACTTATTATGCTGTCAGG - Intergenic
1197711029 X:129667634-129667656 GTTTTCTTTATTGTGGTGAAAGG + Intergenic
1199264275 X:145811994-145812016 GATTTACTGAAGGTTCTGAATGG - Intergenic
1199477518 X:148261855-148261877 GATATACTGAAAGTGCTGAAGGG - Intergenic
1200509188 Y:4055015-4055037 TATTTATTTATTGTGAAGAAGGG - Intergenic