ID: 1112208924

View in Genome Browser
Species Human (GRCh38)
Location 13:97353906-97353928
Sequence CAGAGCTACCACTTTAAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 128}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112208924_1112208925 15 Left 1112208924 13:97353906-97353928 CCTACTTTAAAGTGGTAGCTCTG 0: 1
1: 0
2: 0
3: 11
4: 128
Right 1112208925 13:97353944-97353966 GTTTTCTGACCCCTCAGATCTGG 0: 1
1: 0
2: 0
3: 11
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112208924 Original CRISPR CAGAGCTACCACTTTAAAGT AGG (reversed) Intronic
902640078 1:17761490-17761512 CATAGCTTCGACTTTAAAGTGGG + Intronic
910359725 1:86403675-86403697 GAGAGCCACCACTGAAAAGTTGG + Intergenic
912380751 1:109247038-109247060 CAGAGCCTCCACTGTGAAGTGGG + Intergenic
912604211 1:110971859-110971881 CATAACTCCCACTTAAAAGTGGG - Intergenic
914263349 1:146018224-146018246 CTGAGCTGCCACGGTAAAGTTGG + Exonic
915652257 1:157323388-157323410 GAGAGCTACCTCTTTAAGGTAGG + Intergenic
915660029 1:157396920-157396942 AAGAGCTACCTCTTCAAGGTAGG - Intergenic
916861354 1:168809198-168809220 CAGAGCCAACACTTAAAATTGGG - Intergenic
920839725 1:209544534-209544556 CAGGGCTACCAAGTGAAAGTGGG - Intergenic
920894673 1:210034694-210034716 CCTAGCTTCCACTTAAAAGTGGG + Intronic
921467204 1:215503128-215503150 GAGATCTACCCCTTTAAAGCTGG + Intergenic
1064669230 10:17692168-17692190 CAGATCTACCACTTTCTAGCTGG - Intronic
1068047993 10:51912160-51912182 CAGACACACCATTTTAAAGTAGG + Intronic
1069089759 10:64185665-64185687 CAGAGCTGCCACTACCAAGTTGG - Intergenic
1071443371 10:85724057-85724079 CATAGCAATCACTTTAATGTAGG + Intronic
1074796878 10:116955640-116955662 CAGATCTCCCAGATTAAAGTGGG - Intronic
1078240367 11:9525774-9525796 CACAGCCCCCATTTTAAAGTGGG + Intronic
1083620683 11:64048010-64048032 CTGAGCCACCACTTCAGAGTGGG + Intronic
1086892772 11:92277629-92277651 CAATGCTACCACTTACAAGTGGG - Intergenic
1088162214 11:106886092-106886114 GAGAGCCACCACTATTAAGTGGG + Intronic
1090526090 11:127538826-127538848 TAGAACTATCACTTAAAAGTTGG + Intergenic
1091606282 12:1954676-1954698 CAGAGCTAGCACTGTAGACTGGG - Intronic
1092050451 12:5465982-5466004 CAGCTCTACCACTTACAAGTTGG - Intronic
1098711771 12:73771825-73771847 CAAAGATACCACTTAAAGGTGGG + Intergenic
1110167558 13:72461371-72461393 CACAGATACCAGTTTAAACTAGG - Intergenic
1111451119 13:88418319-88418341 TAGTGCTACCACTATAAAGTGGG - Intergenic
1112208924 13:97353906-97353928 CAGAGCTACCACTTTAAAGTAGG - Intronic
1112414516 13:99193260-99193282 CACAGCTCCCATTTTAAAGGAGG + Intergenic
1114594041 14:23895905-23895927 CAAAGCTACCACACAAAAGTTGG + Intergenic
1115813924 14:37142296-37142318 AAGAGCTACCACTCTGGAGTTGG - Intronic
1118099549 14:62581192-62581214 CAGAGATCCAACTTTAAAGTGGG - Intergenic
1119754547 14:77105965-77105987 CAGAATTACCATTTTAAAGCAGG - Intronic
1120614784 14:86690001-86690023 CAGAACTACCTGTTAAAAGTAGG - Intergenic
1127136290 15:55927177-55927199 CTGAGCTAAGACTTGAAAGTTGG + Intronic
1130831820 15:87608702-87608724 CAGATTTTCCACTATAAAGTGGG - Intergenic
1131371068 15:91882366-91882388 CATAGCTCCCAGTTTAAGGTTGG + Intronic
1133737039 16:8623769-8623791 CACAGCAACCACTTAAATGTAGG + Intronic
1136318479 16:29467380-29467402 CAGAGCTGCAATTTTAAATTGGG - Exonic
1136433054 16:30206729-30206751 CAGAGCTGCAATTTTAAATTGGG - Exonic
1137003834 16:35254358-35254380 TTGAGCTACCACTTATAAGTGGG - Intergenic
1143996826 17:11013674-11013696 CACAGCTGCCACATTAAAGAAGG + Intergenic
1144913025 17:18698629-18698651 CACAACCACCACTTAAAAGTAGG - Exonic
1145242229 17:21246778-21246800 CAGGGCTGCCACTGTAAAGAGGG + Intronic
1146665107 17:34695765-34695787 CAGGGCTCCCACTTTAACCTGGG + Intergenic
1146720610 17:35120937-35120959 CAGAGAAACCACCTTACAGTAGG - Intronic
1152175836 17:78786597-78786619 CTGAGCGACCACCTTAAACTTGG - Intergenic
1156868102 18:41911616-41911638 AAAAGCTACCACTCTAAACTTGG - Intergenic
1157028951 18:43881118-43881140 TTGATCTTCCACTTTAAAGTTGG + Intergenic
1161961207 19:7524219-7524241 CAGACCTGCCACTTTACAGTAGG - Intronic
1162080724 19:8216076-8216098 CAGGGCTACAATTTTAAAGAGGG - Intronic
1162843379 19:13372546-13372568 CAGATCTGCCACTTTCCAGTTGG + Intronic
1165964329 19:39562852-39562874 CAGAGGTGCCACCTGAAAGTTGG + Intergenic
1168567351 19:57435934-57435956 CAGAGTTAGAAGTTTAAAGTTGG + Intronic
925074397 2:1002407-1002429 AAAAGCAACCACTTAAAAGTAGG + Intronic
927143987 2:20148986-20149008 CCAAGCCAGCACTTTAAAGTCGG - Intergenic
930094481 2:47556531-47556553 CAGGGTCACCAATTTAAAGTTGG + Intronic
933243063 2:79944383-79944405 CTGAGTCATCACTTTAAAGTTGG - Intronic
935457772 2:103290028-103290050 CAGAAATACCTCTTTTAAGTAGG - Intergenic
939990939 2:148876103-148876125 CAGAGCTCACACTTTAAAGGGGG - Intronic
941080667 2:161057221-161057243 CAGAGCAACCACTTTAAACAGGG + Intergenic
943329845 2:186545955-186545977 CAGCTCTACCACTTTCTAGTTGG - Intergenic
943776957 2:191775954-191775976 CAGAGCTACCACTAACCAGTTGG + Intergenic
943799931 2:192045155-192045177 TACAGCTACCACCTGAAAGTGGG + Intronic
1169168832 20:3447541-3447563 CAGAGCTTCAACTTTGAAGGAGG + Intergenic
1171402368 20:24883111-24883133 AAAAGCAACCACTTTTAAGTGGG + Intergenic
1174492584 20:50911666-50911688 CAGAGCTACCACATCAAGGATGG + Intronic
1177663028 21:24112622-24112644 CAGAGCTAGCACACAAAAGTTGG - Intergenic
1178150762 21:29790986-29791008 CAGACCACCCAATTTAAAGTTGG - Intronic
1178206092 21:30468329-30468351 CAGAGATACCACGTGAAAGGAGG - Intergenic
1179002702 21:37477935-37477957 CATTTCTACCACTTTAAATTTGG + Intronic
1179978446 21:44884145-44884167 CACAGTTACAATTTTAAAGTAGG + Intergenic
1181178186 22:21049518-21049540 CCCAGCCACCTCTTTAAAGTAGG - Intronic
1181961074 22:26622205-26622227 CAGAGCTACCTCTTTGAGCTAGG + Intronic
1182510809 22:30818863-30818885 CAGAGCAACCAGTTTGATGTGGG + Intronic
1183503959 22:38198640-38198662 CTGAGCTCCCACTTTTAAATAGG + Intronic
1184167257 22:42737169-42737191 CAAAGCAACCACTTCAAATTTGG - Intergenic
1184405324 22:44297568-44297590 CAGAGCTACCACCGTGAGGTGGG - Intronic
949301523 3:2589723-2589745 TAGAGCACCCACTTTCAAGTTGG + Intronic
951362678 3:21743129-21743151 AAGAGATACAACTGTAAAGTAGG + Intronic
953831352 3:46300223-46300245 CAAAGCTCAGACTTTAAAGTAGG - Intergenic
954943253 3:54394031-54394053 CAGAGTTACCACTATGAGGTAGG + Intronic
955456032 3:59122737-59122759 CAGCGCCTCCACTTGAAAGTTGG + Intergenic
955811069 3:62790243-62790265 CAGAGATACTACTATAAAGTTGG - Intronic
956329426 3:68089179-68089201 CAGGGCTAGCAATTTAAATTTGG + Intronic
957085545 3:75673191-75673213 TAGGGCTTCCACTGTAAAGTCGG + Intergenic
958942433 3:100331176-100331198 CTGACCAACCACTTTCAAGTTGG - Intergenic
965406722 3:168278080-168278102 GACAGCTACATCTTTAAAGTTGG + Intergenic
968982402 4:3857344-3857366 CAGGGCTACCACTGTATACTAGG + Intergenic
970716923 4:18937170-18937192 TAGAGCTAGGACTTAAAAGTTGG - Intergenic
972699248 4:41477912-41477934 CACAGCTACCACCTTAATGGTGG + Intronic
975735027 4:77372685-77372707 CAGAGCTACAACTCACAAGTGGG - Intronic
977408991 4:96637147-96637169 CAGAGCTAACACTACAAAGCAGG + Intergenic
977770640 4:100854108-100854130 CAAAGCAACCAGTTTAAATTTGG - Intronic
980203021 4:129679748-129679770 CAGTTCTGCCACTTAAAAGTTGG - Intergenic
980222628 4:129939411-129939433 CAGAGCTACATCTTGAAACTGGG - Intergenic
980227694 4:130008785-130008807 CAGAGCTATCTCTTAAAAGAAGG - Intergenic
986888333 5:12267904-12267926 CATAGCTTCCACTTCTAAGTGGG + Intergenic
992614969 5:78538939-78538961 CAGAGCTAGGAATTTGAAGTAGG - Intronic
992653646 5:78886617-78886639 CAGAGTTAAGACATTAAAGTGGG + Intronic
992681153 5:79154575-79154597 CAGAGCTATCTCTTTACAATGGG + Intronic
994070735 5:95599072-95599094 CAGAGCTAACATTCTAATGTGGG - Intronic
994583201 5:101674144-101674166 CAGAGCTATCACTGCAATGTAGG + Intergenic
995683020 5:114741807-114741829 GTGAGCTACCTATTTAAAGTTGG - Intergenic
999123656 5:149229997-149230019 CAGAGCTATCACATTTAAGGGGG - Intronic
1004590807 6:17050003-17050025 CATAGCTGTCACTTTAAATTTGG - Intergenic
1006562888 6:34928798-34928820 CAGAGCTGCCATTTTCAAGGTGG + Intronic
1008257580 6:49322980-49323002 CAGACCTTCCACTTCAAAGTGGG + Intergenic
1011389737 6:86838632-86838654 CAGAGCTACGTCTTGAAACTGGG + Intergenic
1013336721 6:109170868-109170890 CCAAGCTACCAATTTAAAGCTGG + Intergenic
1015977551 6:138806195-138806217 CTGAGCTACCATTTTAAGCTGGG - Intronic
1017239150 6:152147761-152147783 CAGAGCTTCCACTCTAGTGTGGG - Intronic
1020371060 7:7432455-7432477 CAAAGGTAAGACTTTAAAGTAGG - Exonic
1020718280 7:11707145-11707167 CAAAGCAACCACTTTCAAGTAGG + Intronic
1022197857 7:28086365-28086387 CAGAGCTTCCTCTTTAATTTGGG - Intronic
1022772666 7:33491294-33491316 CAAAGCTACCACATTAAATGTGG + Intronic
1024361895 7:48476891-48476913 CAGAGCTACATCTTGAAACTCGG + Intronic
1027372383 7:77519743-77519765 CAGAGGTACAATTTTAAATTGGG + Intergenic
1028654595 7:93189823-93189845 CAGAGCTGGCACATTCAAGTTGG + Intronic
1029106036 7:98176897-98176919 CAGCACTACCACTTAAGAGTTGG - Intronic
1030732934 7:113011256-113011278 CAGAGCAACTACTTTAGATTAGG - Intergenic
1033762861 7:144455247-144455269 GGGAGTTTCCACTTTAAAGTTGG - Intronic
1036910189 8:12752361-12752383 CAGAGCTAACAAATTAGAGTTGG - Intronic
1042937178 8:74071385-74071407 CAGAGTTAACTCTTTAATGTAGG + Intergenic
1043706895 8:83361397-83361419 CAGAGCTACATCTTGAAACTGGG - Intergenic
1047085087 8:121507103-121507125 CAGTGCTACCACTGTTTAGTGGG - Intergenic
1048818945 8:138361805-138361827 CAGAGCTGTCACTTTAAGGATGG - Intronic
1049517604 8:143069693-143069715 CAGAGCAACCACTTCAAATGTGG - Intergenic
1049748295 8:144272225-144272247 CAGAGCTACAACTTCCAGGTGGG + Intronic
1055760203 9:79598904-79598926 CAGAGCTTCTAGTTTAGAGTAGG + Intronic
1060708107 9:125825874-125825896 CAAAGCTACTACATTAAACTTGG - Intronic
1061751655 9:132782326-132782348 CAGAACAATCACTTTAAAGAAGG - Intronic
1185760595 X:2687557-2687579 AAGAGGTAACACTTTAAAGGTGG + Intergenic
1186091141 X:6050110-6050132 CAGTGCTATCATTTTACAGTGGG - Intronic
1188023405 X:25183649-25183671 CACAGCTAGCACTTCAATGTGGG - Intergenic
1190452848 X:50598189-50598211 CAGGGCTCCCTCTTTCAAGTTGG - Intronic
1192198465 X:69048132-69048154 CATAGACACCATTTTAAAGTTGG - Intergenic
1193797416 X:85892783-85892805 TAGAGCTACTACTTAAAAATGGG - Intronic
1198238037 X:134755277-134755299 AAGAGCTACCACTTAATAGTTGG - Intronic
1198364732 X:135929145-135929167 AAGAGCTTCTGCTTTAAAGTAGG - Intergenic
1198789312 X:140325986-140326008 CAGAGCAACGATTTGAAAGTAGG - Intergenic