ID: 1112208925

View in Genome Browser
Species Human (GRCh38)
Location 13:97353944-97353966
Sequence GTTTTCTGACCCCTCAGATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 157}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112208922_1112208925 23 Left 1112208922 13:97353898-97353920 CCTTCTTTCCTACTTTAAAGTGG 0: 1
1: 0
2: 5
3: 29
4: 342
Right 1112208925 13:97353944-97353966 GTTTTCTGACCCCTCAGATCTGG 0: 1
1: 0
2: 0
3: 11
4: 157
1112208924_1112208925 15 Left 1112208924 13:97353906-97353928 CCTACTTTAAAGTGGTAGCTCTG 0: 1
1: 0
2: 0
3: 11
4: 128
Right 1112208925 13:97353944-97353966 GTTTTCTGACCCCTCAGATCTGG 0: 1
1: 0
2: 0
3: 11
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112208925 Original CRISPR GTTTTCTGACCCCTCAGATC TGG Intronic
900784977 1:4643649-4643671 GGTTTCTAACCCCTGAGAACAGG + Intergenic
904959473 1:34320539-34320561 ATTTCCTCACCCCTCAAATCTGG - Intergenic
907878706 1:58522483-58522505 GCTTTCTTGCCCCTAAGATCAGG + Intronic
908680339 1:66653580-66653602 GTTTCCAGAACCCTCAAATCAGG - Intronic
911178254 1:94839076-94839098 GTTTTGGGACCACACAGATCTGG - Intronic
914431903 1:147626170-147626192 TTTTTCTGACACCACAGCTCTGG - Exonic
915098828 1:153484109-153484131 CTTTTCTGAACCCCCAGATACGG + Intergenic
915428254 1:155844958-155844980 TTGTTCTGACCCCTTAGATGAGG + Intronic
915586545 1:156846772-156846794 GTTGAATGACCCCTCAGCTCTGG - Intronic
917766402 1:178223335-178223357 CTTTCCTGACCCCTCTGACCAGG - Intronic
921856260 1:219988500-219988522 GTTTTGTGCCCCATCAAATCTGG - Intronic
923219756 1:231882323-231882345 GTTTTCTGTCACCTCAAATGAGG + Intronic
924494201 1:244570727-244570749 GTTTTCTGATCCCATACATCTGG - Intronic
1063598967 10:7462957-7462979 GTTCTCTGACCTCCCAGAGCAGG - Intergenic
1068021916 10:51595741-51595763 CTTTTCTGACCTCCCAGACCAGG + Intronic
1069991866 10:72321186-72321208 GGTTCCTGACCCCTCTGATCCGG + Intergenic
1070296974 10:75170410-75170432 GTTTTGTCACCCTTCAGCTCAGG - Intronic
1070969582 10:80552447-80552469 CTTTTCTGTCCCCTCATTTCAGG + Intronic
1075550543 10:123389562-123389584 TTCCTCTGACCCCTCAGATGAGG + Intergenic
1078307300 11:10202912-10202934 GTTTTCAGACACCTGACATCAGG + Intronic
1078445432 11:11401244-11401266 GTACTCTGAGCTCTCAGATCTGG - Intronic
1078907728 11:15703368-15703390 GTTTCCTAACCCATAAGATCAGG - Intergenic
1079927744 11:26516463-26516485 GTTTTCTTCCCCCTCTGAACAGG + Intronic
1081458766 11:43251633-43251655 TTTTCCTGACCCCTCAGACCAGG + Intergenic
1083112792 11:60428527-60428549 ATTTTCTTACCCCTCGAATCTGG + Intergenic
1083727863 11:64637708-64637730 GTTTCTTGATCCCTCAGACCAGG + Intronic
1087995018 11:104794943-104794965 GTTTTCTGGGACCTCAGATGTGG + Intergenic
1093295465 12:17384263-17384285 GTGTTCTGAGCCCACAGATATGG + Intergenic
1095778086 12:46031746-46031768 GTCTTCTCAACCCTCAGACCAGG + Intergenic
1099083560 12:78216961-78216983 CCTTTCTGATCCCTCAGATGAGG + Intergenic
1099805131 12:87508765-87508787 GTTTTCTGACACCAAAGTTCCGG + Intergenic
1101222238 12:102653675-102653697 GTTGGCTCACCCCGCAGATCTGG + Intergenic
1101416108 12:104509483-104509505 GTTTTCTGCCCCCTTATATAGGG - Intronic
1102405531 12:112670875-112670897 GTTTTCCCACCCCTTAAATCTGG - Intronic
1104490798 12:129191054-129191076 GATCTCTGACTCCTCAGACCTGG + Intronic
1106193456 13:27474055-27474077 GTCTTGTGACCCCCTAGATCTGG + Intergenic
1110056251 13:70976287-70976309 GTTTAGTGACACCTTAGATCCGG - Intergenic
1112208925 13:97353944-97353966 GTTTTCTGACCCCTCAGATCTGG + Intronic
1113408369 13:110062518-110062540 CTTTTCTGACTCCACAAATCTGG + Intergenic
1114567583 14:23643970-23643992 GTTTTCTGAACTCTGAGATGGGG + Intronic
1115498959 14:34032497-34032519 GGTTTCTGAACCCTCAGCTCTGG - Intronic
1117598473 14:57348701-57348723 GTTTTCTGTGTCCTCAGATCAGG + Intergenic
1123799949 15:23809194-23809216 GTTTTCAGACCCATCAGGTTGGG + Intergenic
1124483966 15:30100088-30100110 GCTTTCTGACCCCCCAGAGGGGG - Intergenic
1124519614 15:30397136-30397158 GCTTTCTGACCCCCCAGAGGGGG + Intergenic
1124539039 15:30569085-30569107 GCTTTCTGACCCCCCAGAGGGGG - Intergenic
1124759611 15:32438487-32438509 GCTTTCTGACCCCCCAGAGGGGG + Intergenic
1125707445 15:41751762-41751784 GTTTGCTGACCCCTGACATAAGG + Intronic
1126992436 15:54395447-54395469 GTTTTCTGACTCCACAGATTTGG - Intronic
1128660101 15:69493849-69493871 GCTTTATGACTCCTCAGAACTGG - Intergenic
1132545014 16:528865-528887 GTTTCCGCACCCCTCAGACCTGG - Intronic
1134127255 16:11624787-11624809 ATTTCCTTACCCCTCAAATCTGG + Intronic
1134871619 16:17657165-17657187 GTTTTCTGAAGCCTGAGATCAGG - Intergenic
1138573870 16:57894010-57894032 GTTTTCAAACCCTTAAGATCAGG - Intronic
1139546060 16:67650129-67650151 GGTCTCAGACCCCTCAGAGCAGG + Exonic
1141213790 16:82005324-82005346 CTCTTCTGACCCCCCCGATCAGG - Intronic
1144301521 17:13925999-13926021 GTTTTCATACCCCTAATATCAGG - Intergenic
1144888776 17:18481690-18481712 CTTTTCTTGCCCCTCAGGTCAGG - Intronic
1145143431 17:20462608-20462630 CTTTTCTTGCCCCTCAGGTCAGG + Intronic
1147243814 17:39107964-39107986 GTTTCCTGACCTGTCAGATAGGG - Intronic
1147606569 17:41777107-41777129 TTTCTCTGACCCCTGAGATGGGG + Intronic
1149968795 17:61194890-61194912 CTATTCTGACCCCTAAGATGTGG + Intronic
1151100207 17:71547913-71547935 GTTTTCTCACCCCTAAAATGGGG - Intergenic
1151191336 17:72400211-72400233 GTTTCCAGACCCCTCAGTTTAGG + Intergenic
1151810234 17:76435839-76435861 GTTTTCTGTCCCCTCTGTGCCGG - Intronic
1153752209 18:8244400-8244422 GTTTTCTGGACTCTCTGATCTGG - Intronic
1155640651 18:28009867-28009889 GTTTTCTTGATCCTCAGATCAGG - Exonic
1158268009 18:55681452-55681474 GTTGTGTGACCACTAAGATCAGG + Intergenic
1163643694 19:18476314-18476336 GTTTTCTGAGCCCTCATCCCTGG - Intronic
1163674920 19:18650883-18650905 GCTTCCTGACCCCTCAGCCCCGG + Intronic
1166257630 19:41617971-41617993 GTTTTCTTACCTCTCATCTCAGG + Intronic
1166267915 19:41696411-41696433 CTTTTCTGCCCCCTATGATCTGG + Intronic
926251933 2:11159670-11159692 GTGTTCAGACCACTCAGGTCAGG - Intronic
926514412 2:13823757-13823779 GATTCCTGACCCATCAGATGAGG - Intergenic
928051110 2:27996228-27996250 GTTTACTGTCCCCTCTGATAGGG + Intronic
928727428 2:34191338-34191360 GTTTTCTGATACCTCAGGCCAGG + Intergenic
929427387 2:41856978-41857000 GCTTTCTGTACCCTCAGTTCAGG + Intergenic
930435360 2:51334170-51334192 ATTTTCTGACTACCCAGATCTGG + Intergenic
931240330 2:60446583-60446605 GTTCTCTGAGCCCACAGCTCAGG - Intergenic
931914164 2:66934938-66934960 GATTTGTGAGCCCTCACATCAGG + Intergenic
932837957 2:75055040-75055062 GTTTTCTGACATCACAGACCTGG - Intronic
937703387 2:124890085-124890107 ATTTTCTCACCTCTCAAATCAGG - Intronic
939251221 2:139683990-139684012 GTTTCCTGACTCCTCAGCACTGG - Intergenic
940448987 2:153814526-153814548 GTTTCCTCACGCCTCAAATCAGG - Intergenic
941592066 2:167432160-167432182 CTTTTCTGAGTCCCCAGATCCGG - Intergenic
942307697 2:174624976-174624998 TTTTTCTGAGCCCTGAGCTCAGG + Intronic
943652064 2:190467975-190467997 GTTTGCTGACCCCTGAGTTAGGG + Intronic
943836759 2:192524462-192524484 GTCTTCTCAGCCCTCAGACCAGG + Intergenic
944199401 2:197090027-197090049 GTTTTCTTACTCCTCAGGTGTGG - Intronic
946238738 2:218341305-218341327 GCTTCCTGAACCCTCAGCTCAGG - Intronic
1170792835 20:19521801-19521823 GTCTTCTGCCCCCTAAGAACTGG - Intronic
1175867597 20:62188806-62188828 GTTTGTTGACCCCACAGATACGG + Intronic
1176729593 21:10480073-10480095 GTTTTCTAACCCTTCAGGTATGG - Intergenic
1178006543 21:28227025-28227047 GTGTTCTGACACCACAGTTCAGG + Intergenic
1179410898 21:41162419-41162441 ATTTTCTGCCCCCTGAGCTCTGG - Intergenic
1183110208 22:35643099-35643121 GTTCTCTGATCCCTCAGTCCAGG - Intergenic
1183586600 22:38756272-38756294 GTGTTCTGAGCCGCCAGATCGGG - Intronic
1184604448 22:45564127-45564149 GTTTACTGACTCCACAGATCTGG + Intronic
949259915 3:2093630-2093652 GTTTTCAAAACCATCAGATCTGG - Intergenic
950974477 3:17226233-17226255 GAATACTGACCCCTCAGCTCAGG - Intronic
952973217 3:38669905-38669927 GTTTCCTGACCCCTGACAGCTGG - Intergenic
953070447 3:39514678-39514700 GGGTTCAGACCCCTCACATCAGG - Exonic
954446157 3:50547913-50547935 GTTCTCTGGCCCCACAGCTCAGG + Intergenic
955578152 3:60388638-60388660 ATTTTCTGTCTTCTCAGATCTGG - Intronic
957408279 3:79800757-79800779 GTTCTCTGACTCCTCACATCGGG + Intergenic
962804650 3:138918039-138918061 GGTTTCTGCCACCCCAGATCTGG - Intergenic
964339709 3:155695762-155695784 CTTTTCTGACTACTCAGACCAGG - Intronic
964872084 3:161324502-161324524 GTTTTTTGACCTCTGAGAGCAGG - Intergenic
966358027 3:179103099-179103121 GTTTGCTTTCCCCTCAAATCTGG + Intergenic
966658531 3:182387485-182387507 GTTTTCTCATCTCTCAGATGAGG + Intergenic
970248635 4:14091052-14091074 ATTCTCCAACCCCTCAGATCTGG - Intergenic
971085130 4:23266280-23266302 GTGTTCTGACCACTCATATGTGG + Intergenic
972357326 4:38292321-38292343 GTTTTCTGTCTCCTCACATTAGG + Intergenic
976322463 4:83731668-83731690 ATTTTCTGGCCCCTCAACTCTGG + Intergenic
976512916 4:85931385-85931407 ATGTTCTGACCCCTCAAAACAGG + Intronic
976671327 4:87657764-87657786 ATTTTCTGACCTCTTAGACCTGG - Intronic
977462962 4:97348585-97348607 GTTTTCTGACCCCTCCGAGAAGG + Intronic
980761845 4:137244781-137244803 ATTATCTGACCCCTTTGATCTGG - Intergenic
982270084 4:153577624-153577646 GTTTGCTAACCCCTGATATCTGG + Intronic
983275362 4:165610190-165610212 ATTTTCTGCCCACCCAGATCTGG - Intergenic
986256716 5:6107025-6107047 GTGTTCTGCACCCTCAGATAAGG + Intergenic
987240675 5:15995448-15995470 GTTTTCTGACCTCTCATAGAGGG + Intergenic
987393056 5:17394728-17394750 CTTTCCTGACCCCACAGTTCAGG - Intergenic
987541937 5:19267135-19267157 GTTTTCTGATTTCTCAGAACTGG + Intergenic
988923209 5:35963302-35963324 GACTTTTGATCCCTCAGATCGGG + Intronic
989400590 5:41004021-41004043 GTTTCCTCACCCCTCAGAAAGGG - Intronic
990615800 5:57507129-57507151 GTTTTCTAACCCATAAGATGAGG + Intergenic
992820572 5:80491892-80491914 GTTTGCTGACCACTAAGATATGG - Intronic
999007467 5:147998134-147998156 GTTTTCTGACCCTTATGATTAGG - Intergenic
999576623 5:152985368-152985390 GTTTTCTAACCCAAAAGATCAGG - Intergenic
1000164915 5:158639113-158639135 GTATTCTGACCACTCTGATAAGG - Intergenic
1001755732 5:174167147-174167169 GATTTCTGACTCCTCAGGGCTGG - Intronic
1002827686 6:788071-788093 GTTTTCTAAGACCTCAGCTCTGG + Intergenic
1003418756 6:5937357-5937379 CTTTGCTGACGCCTCAAATCAGG + Intergenic
1004381668 6:15137961-15137983 GTTTTCTGCCCCCTGAGACCCGG - Intergenic
1004487088 6:16076870-16076892 ATTATCTGACCACTCAGGTCTGG + Intergenic
1005334091 6:24775580-24775602 ATTTGCAGATCCCTCAGATCAGG - Intronic
1012627326 6:101420152-101420174 GTTTTCTGACCTCTAAAATGAGG - Intronic
1016763319 6:147764225-147764247 ATTATCTGAGCTCTCAGATCAGG + Intergenic
1023103378 7:36740824-36740846 GTTTTCTGACCCCTCCAAGGGGG - Intergenic
1023694530 7:42831080-42831102 GATTTCTGCCTCCTCAGATGGGG + Intergenic
1025728957 7:64093131-64093153 CTTTTCTGACACCACAGAGCTGG - Intronic
1026464911 7:70645558-70645580 GTTTTCTGGCCGCTCTGTTCTGG + Intronic
1028135165 7:87217541-87217563 GTTTTCTCCCACCTCAGACCAGG + Intronic
1030386740 7:108875472-108875494 GCTTTTGGATCCCTCAGATCTGG - Intergenic
1030871952 7:114766363-114766385 CTTCTCTGACCTCTCAGATTAGG + Intergenic
1031276629 7:119732515-119732537 CTTTTCTAAGCCCTCAGATGAGG - Intergenic
1032535000 7:132655718-132655740 GTTTTCTATCCTCTCAGAACTGG - Intronic
1032987873 7:137359016-137359038 GCTTTTGGACCCCTTAGATCAGG - Intergenic
1033727500 7:144134479-144134501 GTTTTCTGTCCTCTGGGATCTGG - Intergenic
1034599991 7:152241499-152241521 GTTTTCTAACCCTTCAGGTATGG + Intronic
1041219302 8:55633158-55633180 GTGTTCTGGCTCCTCAGATGTGG - Intergenic
1041710066 8:60886333-60886355 GTTTTCTGACCCCAGAGCTCTGG - Intergenic
1042836670 8:73085226-73085248 GTTTTCTGTGCCTTAAGATCAGG + Intronic
1044873701 8:96644673-96644695 TTTTTCTGATCTCTCAGTTCGGG + Intergenic
1045557707 8:103230816-103230838 GTGTTCTGACCTCTCACACCAGG - Intergenic
1045920745 8:107525829-107525851 TTTTTCTGACCTTTCTGATCTGG + Intergenic
1050235408 9:3573812-3573834 TTTTACTGTCACCTCAGATCTGG - Intergenic
1053830773 9:42077997-42078019 GTGTTCTGACTCCTCAGCTTGGG - Intronic
1054599785 9:67109440-67109462 GTGTTCTGACTCCTCAGCTTGGG + Intergenic
1058875695 9:109243136-109243158 GTTTATTGACCCCTCAGTTTAGG + Intronic
1059633687 9:116152963-116152985 CTTTTCTGAGCCCCCAGATAAGG - Intergenic
1186610504 X:11134143-11134165 CTTTTCTGCACCCTCAGAACTGG - Intergenic
1192185874 X:68946541-68946563 ATTTGCTGACCCCTCATTTCCGG + Intergenic
1196129650 X:112141457-112141479 GTTTTTTTTCCCCTGAGATCAGG - Intergenic
1196166539 X:112541253-112541275 GTTTTCTGAGCCCTCTGTGCAGG + Intergenic
1197959195 X:131985631-131985653 TTGAGCTGACCCCTCAGATCTGG + Intergenic
1202348653 Y:23962961-23962983 TTTTTCTGCACCCACAGATCTGG + Intergenic
1202522121 Y:25707143-25707165 TTTTTCTGCACCCACAGATCTGG - Intergenic