ID: 1112209116

View in Genome Browser
Species Human (GRCh38)
Location 13:97356759-97356781
Sequence CAGCGAGCACATGATGGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 1, 2: 1, 3: 12, 4: 195}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112209116 Original CRISPR CAGCGAGCACATGATGGCAG TGG (reversed) Intronic
900824323 1:4913921-4913943 AAGAGAGCACATGAGGACAGAGG - Intergenic
902263502 1:15245004-15245026 CAGAGATCACATGATGAGAGAGG + Intergenic
902598677 1:17526214-17526236 CAGGGAGCACAGGAATGCAGGGG + Intergenic
903054437 1:20625776-20625798 CAGTGAGAAAATTATGGCAGTGG - Intergenic
903345811 1:22683635-22683657 CAGGGAGAACAGCATGGCAGGGG - Intergenic
904050789 1:27637043-27637065 CAGGGAGCATTTGATGGCGGAGG - Intergenic
904712397 1:32440202-32440224 CAGTGAGAAAATGATGACAGTGG - Intergenic
905965560 1:42092514-42092536 CAGAGAGCACATGGTGAGAGAGG + Intergenic
906665630 1:47619824-47619846 CAGGGAGCAGATGATTCCAGAGG + Intergenic
907330765 1:53669699-53669721 CAGTTAGCACGTGATGGGAGGGG - Intronic
908580854 1:65515088-65515110 CAGCCAGCAGATGATGGTGGTGG + Intronic
911864249 1:102995889-102995911 CAGGGAGCAGATGGTGTCAGAGG - Exonic
918355958 1:183706724-183706746 CACAGAGCCCCTGATGGCAGAGG + Intronic
918574423 1:186039747-186039769 CAGCAATAACATGGTGGCAGTGG + Exonic
919371002 1:196725705-196725727 CAGAGAACACATGATGAGAGAGG + Intronic
919468865 1:197954268-197954290 CAGTGAGAAAATTATGGCAGTGG + Intergenic
920436196 1:205948530-205948552 CAGCGAGGGTATTATGGCAGAGG + Intergenic
922686021 1:227639297-227639319 CAGGGGGCCCCTGATGGCAGAGG + Intronic
1070495922 10:77022344-77022366 CAACAAGGACATGTTGGCAGAGG + Intronic
1071154785 10:82675784-82675806 CAGTGAGAAAATTATGGCAGTGG - Intronic
1072477118 10:95773045-95773067 CAGAGATCACATGGTGGGAGAGG + Intronic
1073670254 10:105579874-105579896 CAGGGAGCACCTGAAGGCTGGGG - Intergenic
1075267432 10:121014786-121014808 CAGAGATCACATGATGAAAGAGG + Intergenic
1075886037 10:125900093-125900115 CAGCAAGCAGAGGAAGGCAGGGG + Intronic
1075969068 10:126637700-126637722 CAGTAGGCACATGGTGGCAGAGG + Intronic
1076069137 10:127472179-127472201 GAGGGAGCAGATTATGGCAGAGG + Intergenic
1077076477 11:704669-704691 CAGCGAGCACACAAAGGCAGTGG + Intronic
1078093382 11:8281663-8281685 CATGGAGGACAGGATGGCAGGGG - Intergenic
1079345842 11:19651570-19651592 CAGCAAGCCCATGCTGACAGGGG - Intronic
1080540211 11:33257722-33257744 CCGCCAGGACAAGATGGCAGCGG + Exonic
1082802939 11:57427445-57427467 CAGACAGCACATGAGGGCATAGG + Intronic
1084118187 11:67054017-67054039 GAGCGACCACATGAGGGCAGTGG + Intergenic
1084514253 11:69627619-69627641 TAGAGAGCCCAGGATGGCAGTGG + Intergenic
1084604594 11:70165162-70165184 CAGCGTGAACATGGCGGCAGAGG - Intronic
1084698301 11:70769296-70769318 CTGCGAGCAAAGGAGGGCAGTGG - Intronic
1084789293 11:71463363-71463385 CACAGAGCACATGGAGGCAGCGG - Intronic
1085344382 11:75758509-75758531 CAGAGTGCACATGATTGCAGAGG + Intergenic
1089031945 11:115340143-115340165 GAGGGAACACATGATTGCAGTGG - Intronic
1090240302 11:125176886-125176908 CAAGGAGCATAGGATGGCAGAGG - Intronic
1091037087 11:132244099-132244121 CCCCGAGCTCAGGATGGCAGAGG - Intronic
1092306096 12:7302673-7302695 CATTGAGCTCATGGTGGCAGAGG + Intergenic
1094765058 12:33584888-33584910 CAGGAATCACATGAAGGCAGTGG - Intergenic
1096458051 12:51803634-51803656 CAGAGAGAAGATGATGGCTGAGG - Intronic
1096885912 12:54719164-54719186 CAGTGAGAAAATTATGGCAGTGG + Intergenic
1099864632 12:88264245-88264267 CAGAGAACACGTGATGGCAGAGG + Intergenic
1100526961 12:95428643-95428665 CAGAGATCACATGATGAGAGAGG + Intergenic
1101302264 12:103495122-103495144 CAGGGAGCAGATGTGGGCAGGGG + Intronic
1104384563 12:128339175-128339197 CACAGACCACATGCTGGCAGTGG - Intronic
1104728023 12:131089538-131089560 CAGGGAGCACTTGCAGGCAGGGG - Intronic
1107513563 13:41107781-41107803 CAGGGAGCACCTGAAGGCTGGGG + Intergenic
1107530282 13:41276585-41276607 CAGTGAGAAAATTATGGCAGTGG + Intergenic
1107623476 13:42258637-42258659 CAGGGAGAAAATGAAGGCAGAGG - Intergenic
1108995687 13:56731542-56731564 CAGGAATCACATTATGGCAGAGG - Intergenic
1110979294 13:81875121-81875143 CAGCGAGAACATTATGGCAGTGG + Intergenic
1112187815 13:97144763-97144785 CAGCCACCACATGACGGCGGAGG + Intergenic
1112209116 13:97356759-97356781 CAGCGAGCACATGATGGCAGTGG - Intronic
1112317317 13:98374854-98374876 CAGAGATCACATGGTGGGAGAGG + Intronic
1113217137 13:108055403-108055425 CAGAGATCACATGATGAGAGAGG + Intergenic
1113936891 13:113999620-113999642 CATCGAGAACATCCTGGCAGTGG - Exonic
1115151031 14:30285982-30286004 GAGAGAGTACATCATGGCAGTGG - Intergenic
1116615868 14:47137526-47137548 CAGAGATCACATGATGAGAGAGG - Intronic
1117487320 14:56211418-56211440 CAGCTAGTACATGATGGGGGAGG - Intronic
1117514921 14:56491497-56491519 CAGTGACCTCAAGATGGCAGTGG + Intronic
1117834777 14:59792114-59792136 CAGCCATCAAATAATGGCAGCGG - Intronic
1122798526 14:104218305-104218327 CAGAGCCCACATGGTGGCAGCGG + Intergenic
1123063662 14:105605730-105605752 AGGCGAGCACATGAAGGCTGGGG + Intergenic
1202872038 14_GL000225v1_random:173868-173890 CAGCAAGCAGAGGAAGGCAGGGG - Intergenic
1123702735 15:22927905-22927927 GAGCGCGCACGTGATGGAAGTGG - Exonic
1124487313 15:30130433-30130455 CACCTAGCACATGATTTCAGGGG + Intergenic
1124542403 15:30599408-30599430 CACCTAGCACATGATTTCAGGGG + Intergenic
1124549106 15:30661526-30661548 CACCTAGCACATGATTTCAGGGG + Intronic
1124756212 15:32407890-32407912 CACCTAGCACATGATTTCAGGGG - Intergenic
1125825814 15:42675406-42675428 CAGGGAACACTTGATGGAAGAGG - Intronic
1127404764 15:58631073-58631095 CAGAGATCACATGGTGGGAGTGG - Intronic
1130982013 15:88819148-88819170 CAGCCAGTACAGGCTGGCAGAGG + Intronic
1131602510 15:93863714-93863736 CAGAGATCACATGGTGGGAGAGG - Intergenic
1132536231 16:482479-482501 CAGCGGGCACAAGCTGGGAGGGG - Intronic
1132932926 16:2467990-2468012 CAGCGAGAAGGTGATGGCCGTGG - Intergenic
1134418300 16:14063256-14063278 CCCCGAGCACATGGAGGCAGTGG - Intergenic
1134542148 16:15076103-15076125 CAGGGAGCAGAAGAGGGCAGGGG - Intronic
1139348669 16:66321648-66321670 CACTGTGCACATGAAGGCAGAGG + Intergenic
1140021137 16:71239896-71239918 GAGCGAGGACAGGAAGGCAGAGG + Intergenic
1140558165 16:75945651-75945673 CAGCCAGCACATTATTGCATAGG + Intergenic
1141576089 16:84964282-84964304 CAGCAAGCACGTGCTGGCACAGG - Intergenic
1141747335 16:85934403-85934425 CAGAGAGCACATGGTGTGAGGGG + Intergenic
1142032109 16:87843782-87843804 CAGAGAGCCCACGGTGGCAGAGG + Intronic
1143199081 17:5099523-5099545 CAGCGTGAACATGAATGCAGAGG - Intergenic
1143631570 17:8143193-8143215 CAGGCAGCACAGGGTGGCAGAGG + Intronic
1145024346 17:19456590-19456612 CAGTGAGAAAATTATGGCAGAGG - Intergenic
1148475373 17:47925223-47925245 CAGAGAGCACAAGGAGGCAGGGG - Intronic
1152048373 17:77953837-77953859 CAGGGAGGAGGTGATGGCAGGGG - Intergenic
1161698577 19:5783475-5783497 CAGCGAGCTCAAGGTGGCCGAGG - Exonic
1162675775 19:12296915-12296937 CAGTGAGAAAATTATGGCAGTGG - Intergenic
1162821995 19:13228857-13228879 CAGCGAGGTCATGATGCCCGAGG + Intronic
1162863696 19:13527492-13527514 CAGAGACCACATGATGACAGAGG + Intronic
1163129922 19:15265927-15265949 CAGGAAGCACATGCTGACAGGGG + Intronic
1164683301 19:30150261-30150283 CAGTGAGCACCTGATTGCAGGGG + Intergenic
1168060949 19:53891898-53891920 CAGAGAGCAGCTGATGGGAGGGG + Intronic
925666127 2:6258145-6258167 CAGCTAGCAAATGATGGAACTGG - Intergenic
926642649 2:15253834-15253856 CAGTGAGAAAATTATGGCAGTGG + Intronic
927134861 2:20089624-20089646 CAGTGAGAACATTATGGCAATGG + Intergenic
927972906 2:27316847-27316869 CAGCGAGCAGATGCTGGCGCAGG + Intronic
928225335 2:29443552-29443574 CAGCGGGCAAAGGAGGGCAGAGG - Intronic
928671504 2:33607770-33607792 CAGTGAGAAAATTATGGCAGTGG - Intergenic
929558738 2:42942410-42942432 CAGTGTGCACATGGAGGCAGGGG - Intergenic
929870821 2:45757817-45757839 CAGCGTGCTTAGGATGGCAGGGG + Intronic
930653547 2:53986199-53986221 CAGAGAGCACATGGTGAGAGAGG - Intronic
935203975 2:100881921-100881943 CTGCGAGCACATGAGGGAGGTGG - Intronic
936249022 2:110853060-110853082 GACCCAGCACATGCTGGCAGTGG - Intronic
939166401 2:138645636-138645658 CATCGAGCAGATCATGGCTGTGG + Intergenic
941267461 2:163380368-163380390 AAGATGGCACATGATGGCAGAGG - Intergenic
941852373 2:170196674-170196696 CAGTGAGAAAATTATGGCAGTGG + Intronic
942662770 2:178283797-178283819 CAGAGATCACATGGTGACAGAGG + Intronic
946858504 2:223977509-223977531 CAGAGAGGGCATGATGGAAGAGG + Intronic
1178361215 21:31949828-31949850 CAGAGATCACATGGTGGGAGAGG + Intronic
1180286056 22:10745624-10745646 CAGCAAGCAGAGGAAGGCAGGGG + Intergenic
1182814228 22:33145266-33145288 CAGCAGGCACATGGTGGTAGGGG - Intergenic
949360618 3:3228638-3228660 CAGTGAGAAAATCATGGCAGTGG + Intergenic
952105585 3:30065799-30065821 CTCCGAGCCCATGATGGGAGGGG + Intergenic
953515813 3:43591085-43591107 GAGCTACCATATGATGGCAGGGG - Intronic
953791625 3:45951925-45951947 AAGAGAGAACATGAAGGCAGGGG + Intronic
954331714 3:49894607-49894629 CAGCAGCCACTTGATGGCAGAGG + Intronic
955199522 3:56837819-56837841 CTGTGTGCACATGATGGCACAGG - Intronic
961008965 3:123423614-123423636 CAGGGAGCTCTTGAGGGCAGGGG - Intronic
962429378 3:135305542-135305564 CAGAGATCACATGATGAGAGAGG - Intergenic
964055175 3:152446668-152446690 CAGCGAGCACATGATGGCAATGG - Intronic
966191363 3:177274403-177274425 GAGCGTGGACATGATGGCAGAGG - Intergenic
967222257 3:187257192-187257214 CAGGGAGGACATGATCACAGAGG - Intronic
969468882 4:7374782-7374804 GAGGGAGCACAAGATGGCTGTGG - Intronic
969619159 4:8270255-8270277 CAGCGCGCACACGTTGGCATAGG - Exonic
973608302 4:52609497-52609519 CAGGGAGCAAATAATGCCAGTGG - Intronic
974110131 4:57515461-57515483 GGGCATGCACATGATGGCAGTGG - Intergenic
976828327 4:89284701-89284723 CAGTGAGAATATTATGGCAGTGG + Intronic
983095686 4:163558632-163558654 CAGAGAGCACATGAGGGGTGTGG + Intronic
984042054 4:174747214-174747236 CAACGAGGACATAAGGGCAGTGG + Intronic
985396059 4:189545562-189545584 CAGCAAGAACGTCATGGCAGGGG + Intergenic
986525277 5:8667074-8667096 CAGTGAGCACAGAATGCCAGTGG + Intergenic
986918779 5:12660404-12660426 CAGAGATCCCAAGATGGCAGCGG + Intergenic
988255217 5:28810383-28810405 CAGCGGGCACAGGACGGCAGGGG - Intergenic
992069555 5:73136409-73136431 CAGCAGGCTCATGAGGGCAGTGG + Intergenic
996234463 5:121108757-121108779 CAGGGAGCACCTGAAGGCTGAGG - Intergenic
996717467 5:126599569-126599591 CAGTGAGAAAATTATGGCAGTGG - Intergenic
997695859 5:135860178-135860200 CAGTGAGAAAATTATGGCAGTGG - Intronic
997823898 5:137089445-137089467 CAGCTACAACATGATAGCAGAGG + Intronic
999256657 5:150213374-150213396 CAGAGACCACACGTTGGCAGTGG - Intronic
999491860 5:152058881-152058903 CAGCTAGCAAATGGCGGCAGAGG - Intergenic
999885078 5:155913356-155913378 CAGAGAGCACAATATGGAAGAGG + Intronic
1002583863 5:180228968-180228990 CTGCCAGCACATAATGGCAACGG + Intergenic
1004846208 6:19645389-19645411 CATAGAGCACATGATGGCCTGGG - Intergenic
1005261662 6:24067819-24067841 CTGAGAGCACATGTTTGCAGTGG - Intergenic
1005822211 6:29607321-29607343 CAGGGAGCTCATGGTGGCACAGG + Intronic
1006133028 6:31880009-31880031 CTGCGAGCAGCTGGTGGCAGAGG + Exonic
1006144907 6:31953029-31953051 CAGAGATCACAGGATGGGAGTGG - Intronic
1006879541 6:37327118-37327140 CAGGGAGTACATGGTGGCATGGG + Intronic
1007180142 6:39923691-39923713 CAGCCAGCACAGGATGACAGAGG + Intronic
1007806884 6:44457045-44457067 CTGCGAGCAGATGATGAGAGTGG + Intergenic
1008685176 6:53918077-53918099 CTGTGAGCACATGGTGGCACTGG + Intronic
1009688533 6:66994690-66994712 CTGCTATCACATGATAGCAGAGG - Intergenic
1010024915 6:71204112-71204134 CAGAGATCACATGATGAGAGAGG + Intergenic
1010585807 6:77657773-77657795 CAGAGAGCATATAATGGCATAGG - Intergenic
1013312928 6:108914454-108914476 CTGCCACCACCTGATGGCAGTGG + Intronic
1019635622 7:2074179-2074201 CAGCGAGCCCAGGCTGGCTGCGG - Intronic
1022755030 7:33278129-33278151 CAGTGAGAAAATTATGGCAGTGG - Intronic
1023926145 7:44671230-44671252 CAGAGATCACATGGTGGGAGGGG + Intronic
1023929612 7:44697370-44697392 CATGGAGCACATGGTGGCGGTGG - Exonic
1024245245 7:47464786-47464808 CTGAGTGCAAATGATGGCAGAGG - Intronic
1024675708 7:51636415-51636437 CAGTGAGAAAATTATGGCAGTGG - Intergenic
1028383673 7:90228106-90228128 CAGGGAGCACTTCATGGAAGGGG + Intronic
1031643485 7:124194166-124194188 AAGCATGCACATGGTGGCAGTGG + Intergenic
1032548266 7:132761621-132761643 CAGAGAGAACATGGTGGTAGTGG + Intergenic
1036659800 8:10700587-10700609 CAGAGACCAGATGATGGCATGGG - Exonic
1037553318 8:19996396-19996418 CAGAGAGCATAGGATGGCAGGGG + Intergenic
1038398698 8:27266693-27266715 CACTGAGAAAATGATGGCAGTGG + Intergenic
1039961420 8:42250698-42250720 CAGTGGGAAAATGATGGCAGTGG - Intergenic
1040573558 8:48630586-48630608 CAAGGAGCACAGGATGGGAGGGG - Intergenic
1040904896 8:52457812-52457834 CAGAGATCACATGAAGGGAGAGG - Intronic
1043210927 8:77516397-77516419 CAGAGAGCACCTGATTGTAGCGG + Intergenic
1043870690 8:85428270-85428292 CAGTGAGAAAATTATGGCAGTGG - Intronic
1043973819 8:86563264-86563286 CAGTGATCACAGGATGGTAGTGG - Intronic
1045114570 8:98969073-98969095 CAGCAAGAACATGATTCCAGAGG - Intergenic
1047533846 8:125701304-125701326 CAGAGATCACATGGTGACAGAGG + Intergenic
1049090349 8:140509965-140509987 CAGGGAGCACATTTTGGCAGAGG - Intergenic
1049550651 8:143257062-143257084 AACAGAGCACCTGATGGCAGTGG + Intronic
1049796552 8:144499779-144499801 CAGGGAGCACAGGGTGGCGGGGG - Intronic
1053613840 9:39743567-39743589 CAGTGAGAAAATTATGGCAGTGG - Intergenic
1053871878 9:42501524-42501546 CAGTGAGAAAATTATGGCAGTGG - Intergenic
1053900882 9:42794510-42794532 CAGTGAGAAAATTATGGCAGTGG + Intergenic
1054239676 9:62598830-62598852 CAGTGAGAAAATTATGGCAGTGG + Intergenic
1054260764 9:62863033-62863055 CAGTGAGGAAATTATGGCAGTGG - Intergenic
1054553809 9:66633357-66633379 CAGTGAGAAAATTATGGCAGTGG + Intergenic
1057518682 9:95742999-95743021 CTGCGACCACAGGATGGCTGAGG - Intergenic
1057748253 9:97769795-97769817 GAGCGAGCAGATGCTGGAAGTGG - Intergenic
1057897955 9:98924693-98924715 CAGCAAGCACAGAATTGCAGAGG - Intergenic
1057986413 9:99719580-99719602 CAAGGAGAAAATGATGGCAGAGG + Intergenic
1058678583 9:107422345-107422367 GACTGAGCACGTGATGGCAGAGG + Intergenic
1060298585 9:122360452-122360474 CAGCAACCAAAGGATGGCAGGGG + Intergenic
1061750089 9:132771113-132771135 CACACAGCACATCATGGCAGTGG - Intronic
1061877609 9:133552670-133552692 CAGTGATCACATCCTGGCAGTGG + Intronic
1062398581 9:136362653-136362675 CAGCCACCCCAAGATGGCAGAGG + Intronic
1188317460 X:28692033-28692055 CAGAGACCACATGATGAGAGAGG + Intronic
1192936811 X:75869089-75869111 CAGGGAACCCAAGATGGCAGGGG + Intergenic
1193575027 X:83185974-83185996 CAGGGAGGACATGAAGGCTGGGG - Intergenic
1195067164 X:101248147-101248169 CAGTGAGCACGTGATGGATGTGG + Exonic
1196721976 X:118862983-118863005 CAGAGAGCAGAGGATGCCAGAGG - Intergenic
1198808409 X:140510530-140510552 CAGGGGGCGCAGGATGGCAGGGG + Intergenic
1199076639 X:143533395-143533417 CAGTGAGCACATGAGGGTAGAGG - Intergenic
1199360042 X:146907251-146907273 CAGGGAGCTCCTGATGGCTGGGG - Intergenic
1200338403 X:155376154-155376176 CAGAGATCACATGATGAGAGAGG + Intergenic
1200348066 X:155464538-155464560 CAGAGATCACATGATGAGAGAGG - Intergenic
1202628539 Y:56884893-56884915 CAGCAAGCAGAGGAAGGCAGGGG - Intergenic