ID: 1112211204

View in Genome Browser
Species Human (GRCh38)
Location 13:97379623-97379645
Sequence ATGTACAAGCAGAAAGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 229}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112211200_1112211204 25 Left 1112211200 13:97379575-97379597 CCACAGAGCTAAATGAGGAAGCA 0: 1
1: 0
2: 2
3: 16
4: 250
Right 1112211204 13:97379623-97379645 ATGTACAAGCAGAAAGAGCCAGG 0: 1
1: 0
2: 1
3: 18
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112211204 Original CRISPR ATGTACAAGCAGAAAGAGCC AGG Intronic
900377308 1:2361259-2361281 ATAAACAAGAACAAAGAGCCGGG + Intronic
900676538 1:3890690-3890712 GTGCAGAAGCAGAATGAGCCAGG - Exonic
901114342 1:6829695-6829717 ATGTACCCGCAGTCAGAGCCGGG + Intronic
901266751 1:7916558-7916580 ATCCACAAACAGAAAGAGACTGG - Exonic
903311367 1:22459667-22459689 ATAAACAAGCAAAAACAGCCAGG - Intronic
903341527 1:22657942-22657964 TTCTACCAGCAGAAACAGCCTGG + Intronic
905243137 1:36594293-36594315 AGGTACGAGCAGCAAGGGCCAGG - Intergenic
905819403 1:40978438-40978460 GTGTACAAGCCCAAAGAGGCCGG - Intergenic
906519360 1:46458159-46458181 AAGAACAGGCAGCAAGAGCCTGG - Intergenic
906582082 1:46944208-46944230 ATGTAAAACCATAAAAAGCCTGG + Intergenic
906601634 1:47134692-47134714 ATGTAAAACCATAAAAAGCCTGG - Intergenic
907417391 1:54323886-54323908 ATGTACAAGCAGAATGCAGCAGG + Intronic
908000027 1:59670779-59670801 CTGTACAAGCAGGGAGAGCGGGG + Intronic
908295643 1:62709985-62710007 ATGTAAATGCAGAAAGATACAGG - Intergenic
909093280 1:71254125-71254147 ATATACAAGCAGAAATAGCATGG + Intergenic
910766512 1:90787961-90787983 ATGAACAAGCAGAGGGAGACAGG - Intergenic
911001837 1:93174263-93174285 ATGTAAAAGCAAAAAAAGCTGGG - Intronic
914262639 1:146011794-146011816 ATGAAAAAGCTGAAAGAGGCAGG - Intergenic
916972635 1:170041116-170041138 ATTTACAAGCAAAAAGGGCTGGG - Intronic
917566530 1:176217995-176218017 TTTTAAAAGTAGAAAGAGCCAGG - Intergenic
917834433 1:178930152-178930174 ATGAAGCAGCAGAGAGAGCCTGG + Intergenic
918708602 1:187699839-187699861 ATGTACACGCAAACAGAGTCAGG - Intergenic
921437786 1:215147076-215147098 ATGTACAAAGAGACAGAGGCAGG + Intronic
922030563 1:221793647-221793669 TAGACCAAGCAGAAAGAGCCTGG + Intergenic
923098503 1:230794069-230794091 AGGAAGAAGCAGAAAGACCCTGG + Intronic
923521093 1:234735326-234735348 AAGTCCGTGCAGAAAGAGCCTGG - Intergenic
1063114429 10:3063966-3063988 ATGCACAGGCAGAAACAGCAGGG + Intergenic
1063672142 10:8107659-8107681 GTGTCCAAGCTGAAAGAGCCTGG - Intergenic
1063944038 10:11159730-11159752 AGGCAAAAGCAGAAAGAACCTGG - Intronic
1064527560 10:16273612-16273634 AAATACAAGCAGAATTAGCCAGG + Intergenic
1065361422 10:24892714-24892736 GTCCACAAGCAGAAAGAGACTGG + Intronic
1067161405 10:43827905-43827927 CTGGACAAGCAGCAAGAGCTGGG - Intergenic
1069823833 10:71243274-71243296 AGGGCCAAGCAGAAAGAGCCTGG + Intronic
1070653629 10:78255702-78255724 ATGGAAAAGCAGTAAGAGGCTGG - Intergenic
1070888560 10:79925503-79925525 ATCTGCAAGCAGTGAGAGCCTGG + Intergenic
1071072230 10:81708194-81708216 ATGCACATGGATAAAGAGCCAGG - Intergenic
1071836508 10:89423655-89423677 ATGTACAAGCAGAAAGAGAGGGG - Intergenic
1071859331 10:89656388-89656410 ATGTCCAAGCAGAAGAAGTCTGG + Intergenic
1073046487 10:100642138-100642160 ATGTACCAGCTGAAACAGGCAGG + Intergenic
1075209738 10:120480984-120481006 ATGTACAATCAGACAGACACTGG - Intronic
1075338666 10:121627776-121627798 ATGTACAAGCAGGCAGAGTGAGG - Intergenic
1075610922 10:123853990-123854012 CTATATAAGCAGAAAAAGCCAGG - Intronic
1078290541 11:10006336-10006358 ATGTACCAACAGACAGAGGCAGG - Intronic
1079346978 11:19661458-19661480 CTGTACAAACAGAAAAACCCAGG - Intronic
1081279121 11:41187012-41187034 ATGTACAAGCAGAGTGACCTTGG + Intronic
1081720066 11:45282146-45282168 TTGAGCAAGGAGAAAGAGCCAGG - Intronic
1083215316 11:61215097-61215119 AAGCCCAAGCAGCAAGAGCCGGG + Intergenic
1083218200 11:61233926-61233948 AAGCCCAAGCAGCAAGAGCCGGG + Intergenic
1084730215 11:71068190-71068212 ATCTACAAGTAGAAAGAGGAAGG + Intronic
1084899387 11:72298319-72298341 AGGGACAAGCAGCAAGTGCCAGG - Intronic
1085018602 11:73191189-73191211 TTGTACAGACAGACAGAGCCAGG + Intergenic
1085706919 11:78794716-78794738 ATGTAGAAGGAGATTGAGCCAGG + Intronic
1085710992 11:78829129-78829151 GTGGACAAGTAGAAAGAACCAGG - Intronic
1086482531 11:87258358-87258380 ATGTATAAGAGGAAAGAGGCTGG - Intronic
1087397490 11:97619416-97619438 ATATACAAGCAGAGAGCTCCAGG - Intergenic
1089137654 11:116262706-116262728 ATTTAGAAGAGGAAAGAGCCTGG + Intergenic
1090169151 11:124582905-124582927 CTGTACCAACAGAAAGAGTCTGG - Intergenic
1091237213 11:134030416-134030438 ATATAGAAGCCGAAAGAGCTCGG - Intergenic
1091353535 11:134916246-134916268 ATGTACCAGCAGAAGAAACCAGG - Intergenic
1091394314 12:144191-144213 ATGGAGAAGCAGAAAGTGGCAGG + Intronic
1092989892 12:13886534-13886556 ATGAACAAGCAGGAAGGGCCAGG + Intronic
1093698953 12:22195953-22195975 ACATAGAAGCAGAAAGAGGCAGG + Exonic
1101745531 12:107538647-107538669 ATCACCAAGCAGGAAGAGCCTGG - Intronic
1103321986 12:120097461-120097483 ATGCACAGGTAGAAAGAGCTGGG - Intronic
1104573142 12:129942872-129942894 AGGTCCATGCAGACAGAGCCAGG + Intergenic
1107413045 13:40175172-40175194 ATGCAAAAGCAGAGAGAGCTTGG - Intergenic
1107966766 13:45604353-45604375 ATGTCCAACCAGAAAGCCCCGGG + Intronic
1108415294 13:50192311-50192333 ATGGAAATGCAGGAAGAGCCTGG - Intronic
1108854036 13:54771608-54771630 AATTTCAAGCAGAAAGAGCAAGG - Intergenic
1110837446 13:80100802-80100824 ATGTTCTTGCAGAAAGAGCTGGG - Intergenic
1111969051 13:94891590-94891612 GTGGAAAGGCAGAAAGAGCCTGG - Intergenic
1112000113 13:95202332-95202354 ATGTACATGCAGAGAGAGATTGG - Intronic
1112029971 13:95447963-95447985 AAGCAGAGGCAGAAAGAGCCTGG - Intronic
1112211204 13:97379623-97379645 ATGTACAAGCAGAAAGAGCCAGG + Intronic
1112380296 13:98882567-98882589 GTGTCTAAGCAGCAAGAGCCAGG - Intronic
1115770883 14:36663157-36663179 ACCTACAAGCAGAGAGACCCCGG + Exonic
1116741704 14:48763312-48763334 ATATACAAGCTGATAGAGTCGGG + Intergenic
1116998181 14:51346203-51346225 ATGCACTTGCAGAAACAGCCAGG - Intergenic
1118732183 14:68676268-68676290 ATGTACCAGCTGAATGACCCAGG - Intronic
1120646599 14:87081894-87081916 CTGCACAGGGAGAAAGAGCCTGG + Intergenic
1125387044 15:39148786-39148808 ATTTACACTCAAAAAGAGCCTGG + Intergenic
1125639335 15:41216774-41216796 GTCTACATGCAGAAAGAACCTGG - Exonic
1128259428 15:66222228-66222250 GGGTCCAAGGAGAAAGAGCCAGG - Intronic
1128780380 15:70355200-70355222 CTGAAAAAGCAGAAAGAGCTGGG - Intergenic
1130081565 15:80738373-80738395 ATGTACAGGCAGCAAGAGTAAGG + Intronic
1130513266 15:84606400-84606422 ATCTCCATGCAGAAAGAGACAGG - Intronic
1132297915 15:100756927-100756949 ACAAACAAGCAGAAATAGCCAGG - Intergenic
1133483099 16:6190996-6191018 ATGCACAAGCAGACAGAATCGGG - Intronic
1133592056 16:7254810-7254832 ATGAACAAGAAGAAAAAGACTGG + Intronic
1134220327 16:12348529-12348551 ATGTACACACACACAGAGCCGGG - Intronic
1136776200 16:32873108-32873130 ATGGACAAGAAGAAAGAGTAAGG + Intergenic
1136894415 16:33988404-33988426 ATGGACAAGAAGAAAGAGTAAGG - Intergenic
1137912819 16:52395377-52395399 AAGGAAGAGCAGAAAGAGCCTGG + Intergenic
1139660671 16:68418774-68418796 ATTTACAAGGAGACAGAGCCAGG - Intronic
1140242221 16:73213430-73213452 ATGTGCAAGGAGAAAGAGATCGG + Intergenic
1141065856 16:80913068-80913090 TTGGAGAAGCAGGAAGAGCCAGG - Intergenic
1203078615 16_KI270728v1_random:1135217-1135239 ATGGACAAGAAGAAAGAGTAAGG + Intergenic
1143353363 17:6306226-6306248 ATTTACATGGAGAAAAAGCCTGG + Intergenic
1143555669 17:7658354-7658376 ATGTCAAAGCAATAAGAGCCGGG + Intergenic
1146162686 17:30568529-30568551 AGGAACTAGCAGCAAGAGCCAGG - Intergenic
1146607229 17:34271081-34271103 TTTTACAAACAGAAAGACCCAGG + Intronic
1147166924 17:38598458-38598480 CTGCACAAGCAGAAACAGCTAGG + Intronic
1147253448 17:39167053-39167075 AGGCACCATCAGAAAGAGCCAGG - Intronic
1149946631 17:60934860-60934882 ATGTAAAAACAGTAAGAGGCTGG + Intronic
1150177717 17:63079156-63079178 AGGTAAAAGAAGAAAAAGCCAGG + Intronic
1150716814 17:67579216-67579238 CTGCCCAAACAGAAAGAGCCTGG - Intronic
1151308938 17:73281802-73281824 ATGAACACGCAGAACCAGCCAGG - Intergenic
1152938914 17:83155394-83155416 ATTCCCAAACAGAAAGAGCCGGG - Intergenic
1156835938 18:41554600-41554622 ATATACAGGCAGAGAGGGCCTGG + Intergenic
1158319498 18:56247749-56247771 ATGAACCAGCACAAAGAGCTGGG + Intergenic
1159605767 18:70473246-70473268 ATGTACAATCAGAAATATCTGGG + Intergenic
1159612988 18:70546931-70546953 AAGAAAAAGCAGGAAGAGCCTGG - Intergenic
1161712293 19:5855707-5855729 AGGTAAAAGCAAAAAGAGGCTGG - Intergenic
1162894256 19:13755643-13755665 ATTTATGAGCTGAAAGAGCCAGG - Intronic
1166116992 19:40662384-40662406 ATGTACAGGCAGACGGATCCGGG + Intergenic
925386886 2:3468186-3468208 TTGCACAAGCAGAAAGAGAAGGG - Intronic
925852963 2:8101040-8101062 TTGAAGAAGCAGAAAGAGCAAGG - Intergenic
926142942 2:10379256-10379278 ATTTACAAGCAGAAAGAGGGAGG - Intronic
927418865 2:22908468-22908490 ATGGAAAAGTAGAAAGGGCCTGG + Intergenic
927753247 2:25688452-25688474 GTCTACAAGCAGAAAAAGCCTGG - Intergenic
927965847 2:27267614-27267636 ACGGACAAGCAGAGAGGGCCTGG - Intronic
930711036 2:54551353-54551375 ATGTAACAGCAGCCAGAGCCAGG - Intronic
931995517 2:67835693-67835715 ATTTACCATCAGAAAGAGGCAGG + Intergenic
933676086 2:85058917-85058939 ATATACAAGGAGAGAGAGCTGGG - Exonic
939043243 2:137217557-137217579 ATTTACAAGCAGATAGACCTGGG - Intronic
939374789 2:141350279-141350301 ATGTACAAGTAGCAAAGGCCAGG + Intronic
939827194 2:147029006-147029028 AGGTAGAAGCAGGAAAAGCCTGG - Intergenic
940939323 2:159539889-159539911 ATGAATCACCAGAAAGAGCCAGG - Intronic
942605864 2:177690008-177690030 ATGTACAAGCAGATAGGACACGG - Intronic
945284241 2:208066132-208066154 AGGGAGAAGCAGAAAAAGCCAGG + Intergenic
945514318 2:210743888-210743910 AAATACAAACAAAAAGAGCCCGG - Intergenic
947435596 2:230069335-230069357 ATGGACGTGCAGAAAGAGCAGGG - Intergenic
1170767656 20:19304543-19304565 ATGTACAAGGAGGTGGAGCCAGG - Intronic
1170936122 20:20811250-20811272 ATGGAGAAGCAGCAAGAGTCTGG + Intergenic
1172767067 20:37356547-37356569 ATGGACAGGCAGAAGGACCCAGG - Intronic
1172811659 20:37652346-37652368 AAGAAGAAGAAGAAAGAGCCAGG - Intergenic
1173355323 20:42281901-42281923 ATGTACCAACTGAAAGAGCCAGG + Intronic
1174604811 20:51753524-51753546 ATGTACACGCAGAAACAAACAGG + Intronic
1177955512 21:27593520-27593542 GTCTACAACCAGAATGAGCCTGG - Intergenic
1178879640 21:36438834-36438856 ATCAACAAGAAAAAAGAGCCAGG - Intergenic
1178913047 21:36692027-36692049 AAATACAAGCAAAAAGAGCACGG - Intergenic
1178982481 21:37276591-37276613 ATGTAAAAGCAGAAGTTGCCAGG - Intergenic
1179538596 21:42068598-42068620 AGGTGCAGGCAGAAAGAGGCAGG - Intronic
1179549412 21:42134461-42134483 ATGTCCCAGCAGGAAGGGCCTGG + Intronic
1180713730 22:17857595-17857617 ATGTAGAAGCACAAAGAGCTGGG + Intronic
1183432826 22:37775870-37775892 ATGGCAAAGAAGAAAGAGCCAGG + Exonic
1184253902 22:43276356-43276378 ACGTACATGCTGAAAGAGTCTGG + Intronic
1185276905 22:49953783-49953805 ATGGTCAAGCAGGAAGGGCCTGG + Intergenic
950327117 3:12121226-12121248 ATGTGTAAGCAGAAAGAGACAGG - Intronic
951138055 3:19127195-19127217 TTGTACAAGAAGAAAGAGATAGG - Intergenic
951449536 3:22820743-22820765 ATGTGGAAGTAGAAAGGGCCAGG + Intergenic
952482781 3:33778810-33778832 ATGGCAAAGCAGAAAGAACCTGG - Intergenic
955982202 3:64538532-64538554 ATGTATAAACAGAAAAAGTCTGG - Intronic
962555198 3:136542788-136542810 ATGTATAAGCATCAAGTGCCTGG - Intronic
963021369 3:140875573-140875595 ATGTATAACCATAAAGGGCCAGG + Intergenic
964047782 3:152351552-152351574 ATGTACAAGTAAAAAGGGTCAGG - Intronic
964526780 3:157623106-157623128 AGGGACAAGCAGGGAGAGCCAGG + Intronic
965553478 3:169995544-169995566 ATGTAAAACCAGAAAGAGGGGGG - Exonic
966723984 3:183092080-183092102 ATATACAAGGAGAAAGATCCAGG - Intronic
967044227 3:185721836-185721858 CTTTTCAAGCAGAAAAAGCCAGG - Intronic
967440111 3:189497694-189497716 ATAATCAAGTAGAAAGAGCCTGG + Intergenic
968879417 4:3291652-3291674 ATGACCCAGCAGAGAGAGCCAGG - Intergenic
969986424 4:11216125-11216147 ATGGATAAACAGAAAGAGCTTGG - Intergenic
970194400 4:13541267-13541289 CTGCACAAGCAGGAAGCGCCTGG - Exonic
973870468 4:55161027-55161049 ATGTATAGGAAAAAAGAGCCAGG - Intergenic
975077297 4:70226992-70227014 ATTTAGAAGAAGAAAGAGGCAGG - Intronic
976103629 4:81593047-81593069 AAGAACAAGCAGAAGGAGCAGGG + Intronic
977296218 4:95212592-95212614 ATGCAGAAGCAGAAAGAACTGGG - Intronic
979471170 4:121098715-121098737 CTGTAGAAGTAGAATGAGCCTGG - Intergenic
983686860 4:170420676-170420698 ATGTACAAGCTGAAGGGGCTGGG - Intergenic
984732385 4:183079832-183079854 ATGGAGAAGCAGCAGGAGCCAGG + Intergenic
988990084 5:36662147-36662169 ATTTACGCACAGAAAGAGCCTGG - Intronic
991348878 5:65700371-65700393 ATGAAAAAGAAGAATGAGCCGGG + Intronic
992411041 5:76505372-76505394 TGGTAGCAGCAGAAAGAGCCTGG - Intronic
993045688 5:82863787-82863809 ATATATAAGGAGAAGGAGCCAGG - Intergenic
995037082 5:107546337-107546359 ATCCATAAGCAGAAAGAGGCTGG + Intronic
996389531 5:122944635-122944657 ATGGTAAAGCAGCAAGAGCCTGG - Intronic
996880374 5:128290152-128290174 ATGAGCAAACAGAAAGAACCAGG - Intronic
997404406 5:133633433-133633455 ATGTAAAAGCTGAAAGATACAGG - Intergenic
1000187217 5:158870783-158870805 ATAAACAAGTACAAAGAGCCAGG - Intronic
1000700691 5:164445369-164445391 AGGAACAAGCACAAAGATCCTGG - Intergenic
1001409485 5:171500359-171500381 CTGTTCAAGCAGATAGATCCAGG - Intergenic
1001486735 5:172125176-172125198 ATGCAGATGCCGAAAGAGCCAGG - Intronic
1001521270 5:172395185-172395207 GTGTGCAGTCAGAAAGAGCCAGG - Intronic
1001914114 5:175545229-175545251 AAGATCAAGCAGAAAGACCCTGG - Intergenic
1002088503 5:176790968-176790990 ATGGACTAGCAGGAAGAGCCTGG - Intergenic
1003955514 6:11161870-11161892 CTGTACAGGAGGAAAGAGCCTGG + Intergenic
1003976891 6:11353082-11353104 ATGTTCACCCAGAAAGAGCCTGG - Intronic
1004991279 6:21141208-21141230 ATGTAGAAGTAGACAGAGCTTGG - Intronic
1005283828 6:24303075-24303097 ATGAACAAGCAGAGACAGCCGGG - Intronic
1005437932 6:25835264-25835286 ATCTAAAAGCAGTGAGAGCCAGG - Intronic
1006726278 6:36201301-36201323 ATCTGCAAGCAGAAAGGGCTAGG + Exonic
1006788448 6:36683436-36683458 ATGTACAAGTTTAAAGAGCATGG - Intronic
1007880634 6:45162232-45162254 AAGAAGAAGAAGAAAGAGCCAGG + Intronic
1010350725 6:74871231-74871253 AAATACAAGCAGAAAGAGCTGGG + Intergenic
1011167551 6:84466215-84466237 ATGGCAAAGCAAAAAGAGCCAGG - Intergenic
1013919600 6:115387440-115387462 ATGCAAAAGCTGAAAGAGCCTGG + Intergenic
1014152124 6:118069454-118069476 ATATTCCAGGAGAAAGAGCCTGG - Intronic
1014688108 6:124529335-124529357 ATGCACAAACAGAAAGAGAAGGG - Intronic
1015312465 6:131780799-131780821 ATCTGCAGGCTGAAAGAGCCGGG - Intergenic
1015509302 6:134022153-134022175 ATATAGAAGCAGAAAGAACATGG + Intronic
1016506136 6:144781607-144781629 ATTTAAAAGCAAAAAGAGCCTGG + Intronic
1017207031 6:151814059-151814081 AGGAACAGGCAGAATGAGCCCGG - Intronic
1017922213 6:158882494-158882516 GTGTAAAAGCAGGAAGAGGCCGG + Intronic
1018193147 6:161328948-161328970 AGGTACAAAGAGAAAAAGCCTGG + Intergenic
1018435998 6:163759468-163759490 ATGTTCACATAGAAAGAGCCTGG - Intergenic
1018826172 6:167409316-167409338 ACGTACAAGCAGAGAGCGCCTGG - Intergenic
1019887808 7:3920437-3920459 ATCTACGGGGAGAAAGAGCCAGG + Intronic
1021194519 7:17660466-17660488 GTGAGCAAGCAGTAAGAGCCAGG - Intergenic
1021222385 7:17989130-17989152 ATGTAAATCCAGAACGAGCCTGG + Intergenic
1021645787 7:22788285-22788307 CAGAACAAGCAAAAAGAGCCAGG + Intergenic
1022376128 7:29813121-29813143 ATGGGGAAGAAGAAAGAGCCTGG - Intronic
1027163431 7:75818478-75818500 AGGTAAAAAGAGAAAGAGCCAGG + Intronic
1030175859 7:106652503-106652525 AAAAACAAGCATAAAGAGCCTGG + Intergenic
1031141955 7:117952241-117952263 ATATACAAGCAAAAACATCCAGG - Intergenic
1033196215 7:139329707-139329729 CTGTACAAGCAGAAACATACTGG - Intergenic
1034821456 7:154220248-154220270 ATGGAAGAGCAGAAAGGGCCAGG - Intronic
1035772562 8:2159773-2159795 TGGTAGAAGCACAAAGAGCCGGG + Intronic
1036436833 8:8742696-8742718 ATCTGCACGCAGAAGGAGCCTGG + Intergenic
1037690644 8:21178745-21178767 ATGTGCAAGCAGGGAGACCCTGG + Intergenic
1041309750 8:56503430-56503452 ATGTACAAGGAGAAATAAACAGG - Intergenic
1042237894 8:66633204-66633226 ATGTGCAAACAGAGACAGCCAGG + Exonic
1045810438 8:106214939-106214961 ATAGACATGCAGAAAGAGCAGGG + Intergenic
1046250724 8:111627147-111627169 ATATACACACACAAAGAGCCAGG - Intergenic
1047167808 8:122459918-122459940 ATGTTAAAGAAGAGAGAGCCTGG - Intergenic
1048829605 8:138463470-138463492 ATGGTGAAGCAGGAAGAGCCTGG + Intronic
1049448760 8:142647022-142647044 AGGTATAGGCAGAAAAAGCCTGG + Intergenic
1049478651 8:142809576-142809598 AAGTACAAGCACAGAGAGGCGGG + Intergenic
1050261244 9:3842912-3842934 ATCTACCAGCAGAAAGGGCTGGG - Intronic
1053865469 9:42433607-42433629 ATGTCCAAGCTGAAACCGCCAGG + Intergenic
1055862191 9:80765028-80765050 GTGTAAAAGCAGAATGAGCAAGG - Intergenic
1057467549 9:95329463-95329485 TTGTACAAGGAGAAAAAGTCTGG + Intergenic
1057840538 9:98482485-98482507 ACGAACAAGCAGAAAGATCTTGG - Intronic
1058241287 9:102564442-102564464 TTGTAGTAGCAGAAAGACCCTGG + Intergenic
1060299598 9:122367394-122367416 ATGCACAACCAGTAAGAGTCAGG - Intergenic
1061846616 9:133391891-133391913 ATGTACACGCAGCCAGTGCCTGG - Intronic
1185930079 X:4192950-4192972 ATTTCCAAGCAGAAATAACCTGG - Intergenic
1185940060 X:4307956-4307978 ATTTACAGGGAGAAGGAGCCTGG + Intergenic
1189163940 X:38840289-38840311 ATGGACAAGCATAAAGAGGTGGG + Intergenic
1189663756 X:43331223-43331245 GTGTGTGAGCAGAAAGAGCCTGG + Intergenic
1193929620 X:87535988-87536010 ATGTACAAGAAGCATAAGCCTGG - Intronic
1195574717 X:106437030-106437052 TTGTAGCAGCAGAAAGAACCGGG - Intergenic
1196050096 X:111295865-111295887 ATGGAGAAGAAGAAAGGGCCAGG + Exonic
1196766307 X:119247901-119247923 AAGTACCAGCTGATAGAGCCAGG - Intergenic
1197165092 X:123368397-123368419 AGGTAAAAGCAGAAAGAGATGGG - Intronic
1197866886 X:131028543-131028565 ATGTTATAGGAGAAAGAGCCTGG + Intergenic
1198391806 X:136182798-136182820 ATGTATAAGAACAAAGAGGCTGG + Intronic
1199213014 X:145236076-145236098 ATGTACAAGCAGAAATCACGTGG + Intergenic
1202129941 Y:21600451-21600473 TGGTACAGGCAGAATGAGCCTGG + Intergenic