ID: 1112213067

View in Genome Browser
Species Human (GRCh38)
Location 13:97400758-97400780
Sequence TGATGGAACAGATGTCAGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112213063_1112213067 3 Left 1112213063 13:97400732-97400754 CCAATGCCACTCCACAAAAGGGA No data
Right 1112213067 13:97400758-97400780 TGATGGAACAGATGTCAGTATGG No data
1112213064_1112213067 -3 Left 1112213064 13:97400738-97400760 CCACTCCACAAAAGGGAGTGTGA No data
Right 1112213067 13:97400758-97400780 TGATGGAACAGATGTCAGTATGG No data
1112213060_1112213067 8 Left 1112213060 13:97400727-97400749 CCAGTCCAATGCCACTCCACAAA No data
Right 1112213067 13:97400758-97400780 TGATGGAACAGATGTCAGTATGG No data
1112213066_1112213067 -8 Left 1112213066 13:97400743-97400765 CCACAAAAGGGAGTGTGATGGAA No data
Right 1112213067 13:97400758-97400780 TGATGGAACAGATGTCAGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112213067 Original CRISPR TGATGGAACAGATGTCAGTA TGG Intergenic
No off target data available for this crispr