ID: 1112216366

View in Genome Browser
Species Human (GRCh38)
Location 13:97434432-97434454
Sequence GTCGCGGGCGGCGGCGGCGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 5534
Summary {0: 1, 1: 18, 2: 105, 3: 1705, 4: 3705}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112216354_1112216366 21 Left 1112216354 13:97434388-97434410 CCGGGGCCGGGGCTGGGGGCGCA 0: 1
1: 0
2: 14
3: 154
4: 1316
Right 1112216366 13:97434432-97434454 GTCGCGGGCGGCGGCGGCGGCGG 0: 1
1: 18
2: 105
3: 1705
4: 3705
1112216353_1112216366 24 Left 1112216353 13:97434385-97434407 CCGCCGGGGCCGGGGCTGGGGGC 0: 1
1: 1
2: 18
3: 143
4: 882
Right 1112216366 13:97434432-97434454 GTCGCGGGCGGCGGCGGCGGCGG 0: 1
1: 18
2: 105
3: 1705
4: 3705
1112216360_1112216366 -8 Left 1112216360 13:97434417-97434439 CCGGCGTAGGTCTATGTCGCGGG 0: 1
1: 0
2: 0
3: 1
4: 7
Right 1112216366 13:97434432-97434454 GTCGCGGGCGGCGGCGGCGGCGG 0: 1
1: 18
2: 105
3: 1705
4: 3705
1112216355_1112216366 15 Left 1112216355 13:97434394-97434416 CCGGGGCTGGGGGCGCAGCGCGG 0: 1
1: 2
2: 11
3: 100
4: 545
Right 1112216366 13:97434432-97434454 GTCGCGGGCGGCGGCGGCGGCGG 0: 1
1: 18
2: 105
3: 1705
4: 3705

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112216366 Original CRISPR GTCGCGGGCGGCGGCGGCGG CGG Exonic
Too many off-targets to display for this crispr