ID: 1112216644

View in Genome Browser
Species Human (GRCh38)
Location 13:97437325-97437347
Sequence GTGGCCACAGGCTGCCATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 652
Summary {0: 1, 1: 0, 2: 12, 3: 103, 4: 536}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112216640_1112216644 26 Left 1112216640 13:97437276-97437298 CCACATCTCAATTCAAACAAGTC 0: 1
1: 0
2: 3
3: 20
4: 253
Right 1112216644 13:97437325-97437347 GTGGCCACAGGCTGCCATATTGG 0: 1
1: 0
2: 12
3: 103
4: 536
1112216639_1112216644 30 Left 1112216639 13:97437272-97437294 CCTACCACATCTCAATTCAAACA 0: 1
1: 0
2: 2
3: 22
4: 309
Right 1112216644 13:97437325-97437347 GTGGCCACAGGCTGCCATATTGG 0: 1
1: 0
2: 12
3: 103
4: 536

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112216644 Original CRISPR GTGGCCACAGGCTGCCATAT TGG Intronic
900875962 1:5342841-5342863 GTGGCCAGGGGCTGTCAGATTGG + Intergenic
901404953 1:9039457-9039479 GGGGCCACGGGCTGCCCTTTTGG + Intronic
901715869 1:11153684-11153706 GTGGCCAGTGGCTGCTGTATTGG - Intronic
901715929 1:11154111-11154133 GTGGCTAGAGGCTACCATATTGG + Intronic
901721259 1:11199856-11199878 GTGATCACTGGCTACCATATTGG - Intronic
902150559 1:14439579-14439601 GTGGCCAGTGGCTACCATACTGG - Intergenic
902215615 1:14932560-14932582 GTGGCTAGAGGCTCCCATGTTGG + Intronic
902246047 1:15121142-15121164 GTTGCCTGTGGCTGCCATATTGG - Intergenic
903240518 1:21979788-21979810 GTGGCTAGTGGCTACCATATTGG + Intronic
903244260 1:22004407-22004429 GTGGCTAGTGGCTACCATATTGG + Intronic
903398972 1:23025093-23025115 GTGGCTACAGGCTACCATATTGG - Intronic
904799358 1:33081791-33081813 GTGGCCACCGGCTACCCTCTAGG + Exonic
904868541 1:33601871-33601893 GTAGCCAGTGGCTACCATATTGG + Intronic
905107727 1:35574145-35574167 GGGGCGCCAGGCCGCCATATGGG - Exonic
905555709 1:38881672-38881694 TTGGCTACTGGCTGCCTTATTGG - Intergenic
905714405 1:40135618-40135640 GTGGCCACAGGTTACCATATTGG + Intergenic
906917396 1:50025676-50025698 GTGGCTACTGGCTACCATATTGG + Intergenic
907345602 1:53776317-53776339 GTGGCTAGTGGTTGCCATATTGG - Intronic
907983840 1:59511035-59511057 GTGACTAGTGGCTGCCATATTGG + Intronic
908294053 1:62695252-62695274 GTGGCTAAGGGCTGCCATACTGG + Intergenic
908492490 1:64660324-64660346 GTGGCTAGTGGCTGCCATATTGG - Intronic
910544345 1:88397211-88397233 GTGGCTAGTGGCTACCATATTGG - Intergenic
911097520 1:94066854-94066876 GTGGCTCCTGCCTGCCATATTGG - Intronic
912251232 1:108014592-108014614 GTAGCCACTGGCTACCATACTGG + Intergenic
912929196 1:113941263-113941285 GTGGCCACCTGCTGCAAGATTGG - Exonic
912958272 1:114171798-114171820 ATGGCCAGTGGCTACCATATTGG + Intergenic
912979580 1:114358507-114358529 GTGGCCACAAGGTACCAAATTGG + Intergenic
913091215 1:115477946-115477968 GTGGCTAGTGGCTACCATATTGG - Intergenic
913583286 1:120248647-120248669 GTGGCAACAAGCTACTATATTGG - Intergenic
913624886 1:120649675-120649697 GTGGCAACAAGCTACTATATTGG + Intergenic
914095341 1:144540042-144540064 GTGGGCACAGGCTGCCTCACTGG - Intergenic
914303185 1:146393854-146393876 GTGGGCACAGGCTGCCTCACTGG + Intergenic
914565273 1:148860483-148860505 GTGGCAACAAGCTACTATATTGG - Intronic
914607552 1:149269765-149269787 GTGGCAACAAGCTACTATATTGG + Intergenic
914838756 1:151230246-151230268 GTGGCTACTAGCTACCATATTGG - Intronic
914912401 1:151798215-151798237 GTGGCCAATGGCTACCATATTGG - Intergenic
916564146 1:165958613-165958635 GTGGGCAGAGGCTGCCATGCAGG + Intergenic
917177351 1:172251119-172251141 GTGGCTAGTGGCTACCATATTGG + Intronic
917287759 1:173439538-173439560 GAGGCCACAGGCTGCCACTCAGG - Intergenic
918333892 1:183488297-183488319 GTGGCCAGTGGGTACCATATTGG - Intronic
918333916 1:183488581-183488603 GTGGCTAGTGACTGCCATATTGG + Intronic
919675313 1:200376492-200376514 GTGGCCAGAGGCCACCATATTGG + Intergenic
919754053 1:201055516-201055538 GTGGCTAATGGCTACCATATTGG - Intronic
920035795 1:203064561-203064583 CTGCCCACAGGCTGCCAGTTTGG - Intronic
920517979 1:206600666-206600688 GTGGCCAGTGGCTACCACATTGG + Intronic
921129249 1:212205833-212205855 ATGGCCAGTGGCTACCATATTGG + Intergenic
921251214 1:213300305-213300327 ATGGCCACTGGCAACCATATTGG + Intergenic
921947677 1:220897340-220897362 GTGGCTAGTGGCTGTCATATTGG + Intergenic
922609640 1:226915910-226915932 GTGGCTAGTGGCTACCATATTGG - Intronic
922644800 1:227275994-227276016 CTGGGCAGAGGCTGCCATCTCGG - Intronic
923034512 1:230276255-230276277 GTGTCCACAAGCTGCCACAAGGG - Intronic
923282600 1:232459186-232459208 GTTGCTAGTGGCTGCCATATTGG - Intronic
923365497 1:233256630-233256652 GTGGCCACTGGCTACCATATTGG + Intronic
923786521 1:237073438-237073460 ATGGCCAGTGGCTGCCATACTGG - Intronic
923883164 1:238126260-238126282 GTAGCCAATGGCTACCATATTGG + Intergenic
924151400 1:241134076-241134098 GTGGCTAATGGCTACCATATTGG - Intronic
924535168 1:244929453-244929475 GTGGCCAGTGACTTCCATATTGG + Intergenic
924910068 1:248500536-248500558 GTGGCCACAGGATATCATCTGGG - Intergenic
924914036 1:248547519-248547541 GTGGCCACAGGATATCATCTGGG + Intergenic
1062772034 10:109493-109515 GTGACCACTGGCTACCATGTTGG - Intergenic
1063232320 10:4077299-4077321 GTGGCAAGTGGCTCCCATATGGG - Intergenic
1063476650 10:6334607-6334629 GTCGCCAGTGGCTACCATATTGG + Intergenic
1063683683 10:8214822-8214844 GTGGCAAGTGGCTGCCATATTGG + Intergenic
1064082954 10:12323251-12323273 GGGGCCACAGGCTGGTATTTGGG + Intergenic
1064234696 10:13563380-13563402 CTGGCCACAGGCTCCCAAAAGGG - Intergenic
1064395054 10:14975246-14975268 GTGTACACAGCCTGCGATATTGG - Intronic
1064814084 10:19236386-19236408 GTGGTCACAGGTTGCCCCATGGG - Intronic
1068010598 10:51445168-51445190 GTGGCAACTGACTACCATATAGG + Intronic
1068336920 10:55645497-55645519 GTGGCTAGTGGCTACCATATTGG + Intergenic
1068569191 10:58609722-58609744 GTGGCCAGTGGCTGTCATATTGG + Intronic
1068829775 10:61480157-61480179 GTGGCTAGTGGCTACCATATTGG + Intergenic
1068923301 10:62508778-62508800 GTGACCAATGGCTGCCATACTGG - Intronic
1070351804 10:75599696-75599718 GTGGCTAGTGGCTACCATATTGG - Intronic
1071592224 10:86885556-86885578 GTGGCTAGTGGCTACCATATGGG + Intronic
1071791527 10:88959203-88959225 GTGGCTACTGACTTCCATATTGG + Intronic
1072575808 10:96699269-96699291 GTAGCCAGTGACTGCCATATTGG - Intronic
1073050977 10:100667343-100667365 GTGGCTAGTGGCTACCATATTGG + Intergenic
1074661706 10:115666617-115666639 GTTGCCAGTGGCTGTCATATTGG - Intronic
1074690780 10:116002444-116002466 GTGGCCAGTGGCTACCATGTTGG + Intergenic
1074801532 10:117005351-117005373 GCAGCCACAGGCTGGCATAGCGG - Exonic
1074986645 10:118665492-118665514 GTGGCCAGTGGCTACCATACCGG - Intergenic
1075145591 10:119880411-119880433 GTGGCTAGAGGCTACCAGATTGG + Intronic
1075535335 10:123266773-123266795 GTGGCAACAGGGGGCCATCTTGG + Intergenic
1075644068 10:124086214-124086236 GTGGCCACAGTGTGTCAAATCGG - Intronic
1076295059 10:129377734-129377756 GTGGCCAGGGGCTCCCATATTGG + Intergenic
1076325768 10:129621030-129621052 GTGGCCAGTGCCTGCCATACTGG - Intronic
1076380218 10:130020210-130020232 GTGGCCAGTGGCTGCCATATTGG + Intergenic
1077879304 11:6335673-6335695 GTGGCCAGTGGCTATCATATTGG - Intergenic
1077879312 11:6335799-6335821 GTGGCAAGTGGCTACCATATTGG + Intergenic
1078707567 11:13759998-13760020 GTAGCCAGTGGCTGCCATATTGG + Intergenic
1079464687 11:20718319-20718341 GTGGCCAGTGGCTGCTTTATTGG + Intronic
1079506773 11:21161873-21161895 GTGGCTAATGGCTGCCATATTGG + Intronic
1079658516 11:23012056-23012078 GTGGCTAGTGGCTACCATATCGG + Intergenic
1080610344 11:33898734-33898756 GGGGCCAGTGGCTACCATATTGG + Intergenic
1080643961 11:34174706-34174728 GAAGCCACAGGCTGCCATCCGGG - Intronic
1080666568 11:34341533-34341555 GTGGCTAGTGGCTACCATATTGG - Intronic
1080988344 11:37499256-37499278 GTGCCCAGTGGCTACCATATTGG - Intergenic
1081546069 11:44072771-44072793 GTGGCCAGTGGCTACCATGTTGG + Intronic
1081689150 11:45064543-45064565 GTGGCAACTGGCTACCATATTGG - Intergenic
1082206634 11:49443351-49443373 TTGGCCAGATGTTGCCATATAGG + Intergenic
1083923885 11:65794474-65794496 GGGGCCACAGGCTGGCAGATTGG - Intronic
1085029457 11:73261248-73261270 GTGGCCAGAGGCTACCCTACTGG + Intergenic
1085400332 11:76232194-76232216 GTGGCCACAGGCTGCATAAAGGG + Intergenic
1085680324 11:78568156-78568178 GTGGCTACTGGCTACTATATTGG - Intronic
1086648634 11:89258413-89258435 TTGGCCAGATGTTGCCATATAGG - Intronic
1086701818 11:89907106-89907128 GTGGACACACCCTGCGATATGGG + Intergenic
1086704350 11:89937419-89937441 GTGGACACACCCTGCGATATGGG - Intergenic
1087023787 11:93629614-93629636 GTGGCTAGTGGCTGCCATATTGG + Intergenic
1087062141 11:93989898-93989920 GTGGCCAGTGGCTACCATACTGG + Intergenic
1087760424 11:102099231-102099253 ATGGCTAGTGGCTGCCATATTGG + Intergenic
1087905751 11:103695055-103695077 GCTGCCACAGCCTGCCATGTGGG + Intergenic
1088150696 11:106741342-106741364 GTGGCTAGTGGCTACCATATTGG + Intronic
1089218109 11:116847979-116848001 GTGGCTACTGGTTACCATATTGG - Intronic
1089710350 11:120310099-120310121 GTTGACACAGGCTGCTATGTGGG + Intronic
1090331391 11:125935178-125935200 GTGGCTAGAGGCTACCATATTGG + Intergenic
1091285605 11:134407061-134407083 GTGGCTAGAGGCTGCCATCTTGG - Intronic
1091523590 12:1273561-1273583 GTGGCTAGAGGCTACCATCTTGG - Intronic
1091957789 12:4662151-4662173 GTGGCAGCAGGCTGCAATAATGG - Intronic
1092997704 12:13965382-13965404 AGGGCCAAAGGCTGCCATTTGGG - Intronic
1093479669 12:19591622-19591644 GTGGCTAGGGGCTACCATATTGG + Intronic
1093548554 12:20377497-20377519 GTGGCTAATGGCTACCATATTGG + Intronic
1094021473 12:25918980-25919002 GTGGCCAAGGGCTACCATATTGG - Intergenic
1094399109 12:30041978-30042000 GTCCCCACAGGCTGTCATCTTGG - Intergenic
1095148221 12:38756803-38756825 GTGGCTAGGGGCTGCCATATTGG - Intronic
1095172337 12:39050629-39050651 GGGGCTAGGGGCTGCCATATTGG + Intergenic
1095580908 12:43796667-43796689 GTGGCTACTGGCTACCGTATTGG - Intronic
1095995513 12:48080198-48080220 GTGGCTAGTGGCTACCATATTGG - Intronic
1096185591 12:49578506-49578528 GTGCTGACAGGCTGCCTTATGGG + Intronic
1096606559 12:52770533-52770555 GTGGCTACTGGCTACCATACTGG - Intronic
1096607598 12:52777749-52777771 GTGTCCACAGGCTCCCACAGTGG + Intergenic
1096989139 12:55784701-55784723 GTGGCTAGTGGCTACCATATCGG - Intronic
1097305111 12:58060045-58060067 AAGGACACAGGCTGCCAAATTGG + Intergenic
1097380647 12:58891819-58891841 GTGGCTAGTGGCTGCCATACTGG - Intronic
1097435221 12:59546590-59546612 GTGGACACTTGCTGCGATATTGG - Intergenic
1097831724 12:64231759-64231781 GTGGCTAGTGACTGCCATATTGG + Intergenic
1098156563 12:67605572-67605594 GTGGCTAGTGGCTACCATATTGG - Intergenic
1098607727 12:72413326-72413348 GTGGCTAGTGGCTACCATATTGG - Intronic
1099324431 12:81196253-81196275 GAGGCCAGAGGCTACCATATGGG - Intronic
1100302245 12:93318536-93318558 GTGGCTAGTGGCTGCCATCTTGG + Intergenic
1101129150 12:101671109-101671131 GTGGCTAGTGGCTACCATATTGG - Intronic
1101269060 12:103123596-103123618 GTGGCTAATGGCTACCATATTGG - Intergenic
1101351869 12:103937212-103937234 GTGCCCAGTGGCTGCCATTTTGG + Intronic
1101598633 12:106189334-106189356 GTGGCAAGTGGCTTCCATATTGG - Intergenic
1102408178 12:112692518-112692540 GTGGCCAGTGGCTACCATATTGG + Intronic
1102761191 12:115386845-115386867 GTGGCTAGTGGCTACCATATTGG + Intergenic
1102773352 12:115497849-115497871 GTTGCCAAAGGCTGGCAAATGGG - Intergenic
1102800992 12:115733744-115733766 GTGGCTAGTGGCTACCATATTGG - Intergenic
1102801003 12:115733843-115733865 GTGGCTAGTGGCTACCATATTGG + Intergenic
1102809097 12:115808613-115808635 GTGGCCAGTGGCTACCATATTGG + Intergenic
1102981712 12:117246921-117246943 GTGGCTAGTGGCTACCATATTGG + Intronic
1102994288 12:117336434-117336456 GTGTCAAGCGGCTGCCATATTGG - Intronic
1103043577 12:117716353-117716375 GTGGCCAGTGGATGCCATATTGG - Intronic
1103072559 12:117956876-117956898 GTGGCAAGTGGCTGCCATACTGG + Intronic
1103245475 12:119453236-119453258 GTGTTCACAGGCTGTGATATGGG + Intronic
1103357347 12:120331534-120331556 GTGGCGAGTGGCTGCCAGATTGG + Intergenic
1103890625 12:124236117-124236139 GTGGCCAGCAGCTACCATATTGG - Intronic
1104054213 12:125216919-125216941 GTGGCCACTGGCTGCGATCTTGG + Intronic
1104067058 12:125314857-125314879 GTGGGCACTGGCTGCCATGTGGG + Intronic
1104069224 12:125330000-125330022 ATGGCCACAGGCTGCCAGCAGGG - Intronic
1104397874 12:128450249-128450271 GTGGCTACTGGCTATCATATTGG + Intronic
1107548173 13:41453132-41453154 GTGTCCACAGCCTGCGATATTGG + Intergenic
1107631882 13:42351032-42351054 GTGGCCAATGGCTACCTTATTGG - Intergenic
1107637185 13:42404386-42404408 GTGGCTCATGGCTGCCATATTGG + Intergenic
1108338745 13:49474906-49474928 GTGCCCACTGGCTACCATATCGG + Intronic
1108817988 13:54314364-54314386 GTGGACACAGCCTGCGATACTGG + Intergenic
1108931997 13:55836776-55836798 GTGGCAAGTGGCTGCCATACTGG + Intergenic
1111395680 13:87665959-87665981 GTGGCCAATGGCTATCATATTGG + Intergenic
1111441282 13:88285487-88285509 GAGGGGACAGGCTGCCATAAAGG - Intergenic
1112216644 13:97437325-97437347 GTGGCCACAGGCTGCCATATTGG + Intronic
1112219823 13:97476735-97476757 GTGGCCAATGGCTACCATATTGG - Intergenic
1112307022 13:98284044-98284066 GTGGCTGGTGGCTGCCATATTGG + Intronic
1112391743 13:98991424-98991446 GTGGCTAGTGGCTACCATATTGG - Intronic
1112521376 13:100098384-100098406 GTGGCTCGTGGCTGCCATATTGG + Intronic
1112522080 13:100105229-100105251 GTGGCCAGTGGCTACTATATTGG + Intronic
1115099170 14:29676870-29676892 GTGGCCAGTGGCTACCATATTGG - Intronic
1115125706 14:29990225-29990247 GTGCCCACAGGCCACCACATAGG + Intronic
1116519375 14:45831185-45831207 GTGTCCACCTCCTGCCATATCGG + Intergenic
1117453252 14:55872725-55872747 GTGACGACAGCCTGCCATGTGGG - Intergenic
1117482039 14:56156648-56156670 GTGGCCAGTGGCTACCATACTGG - Intronic
1117880611 14:60309778-60309800 GTGGCTAGTGGCTACCATATTGG + Intergenic
1118180734 14:63490128-63490150 GTGGCTAGTGGCTGCTATATTGG - Intronic
1118372441 14:65149082-65149104 ATGGCTAGTGGCTGCCATATTGG - Intergenic
1119167649 14:72508438-72508460 GGGGCTAGTGGCTGCCATATTGG + Intronic
1119473752 14:74915122-74915144 GTGGCTACTGGCTTCCATATTGG - Intronic
1120485698 14:85111343-85111365 GTGGCTAGTGGTTGCCATATTGG + Intergenic
1120869569 14:89324984-89325006 GTGGCAAGAGGCTACCATGTTGG - Intronic
1121265686 14:92600976-92600998 GTGGCCCCTGGCTACCATACTGG - Intronic
1121507240 14:94486444-94486466 GTGGCCACAGGCGGCCCTGCAGG + Intergenic
1121926874 14:97935044-97935066 GTGGTCACCTACTGCCATATGGG + Intronic
1122144419 14:99681070-99681092 GTGGCCAATGGCTGCCACATTGG + Intergenic
1124049664 15:26184952-26184974 GTGGCCAATGGCTGACATATTGG - Intergenic
1124840256 15:33234800-33234822 GGGGGCAGAGGCAGCCATATGGG + Intergenic
1124996667 15:34729806-34729828 GTGGCCAGTGACTACCATATTGG + Intergenic
1125076148 15:35620723-35620745 GTGGCTAGTGGCTACCATATTGG - Intergenic
1125144405 15:36450003-36450025 GTGGCTAGTGGCTGCCATATTGG - Intergenic
1125371934 15:38986976-38986998 ATGGCCAATGGCTACCATATTGG + Intergenic
1125488244 15:40127264-40127286 GTGTACACAGACTGCGATATTGG - Intergenic
1126570129 15:50141829-50141851 GTTTCCAGTGGCTGCCATATTGG + Intronic
1126990342 15:54367808-54367830 GTGGCTAGAGGCTTCCATATTGG - Intronic
1128420424 15:67486926-67486948 GTGGCTATTGGCTACCATATTGG + Intronic
1129147047 15:73657601-73657623 GTGACAAGTGGCTGCCATATTGG + Intergenic
1129610660 15:77053067-77053089 GTGGCTAGTGGCTGCTATATTGG - Intronic
1129658209 15:77538717-77538739 GTGGCTAGTGGCTACCATATTGG - Intergenic
1131404644 15:92154491-92154513 GTGGCCAGTGTCTGCCATACTGG + Intronic
1131715803 15:95109812-95109834 GTGGCTAGAGGCTACCATACCGG + Intergenic
1132130162 15:99269787-99269809 GTGGCTAGTGTCTGCCATATTGG + Intronic
1132270901 15:100523856-100523878 GTGGCTAGCAGCTGCCATATTGG + Intronic
1132589990 16:722384-722406 GCGGTCACAGGCTGCCAGGTGGG - Exonic
1133610211 16:7426379-7426401 ATGGGCACAGGCTGCCGAATTGG + Intronic
1133867305 16:9656139-9656161 GTGGCTAGTGGCTTCCATATTGG - Intergenic
1133991280 16:10709531-10709553 GTGTACACAGCCTGCGATATTGG + Intergenic
1133993432 16:10728481-10728503 GTGGCCACTGGCTATCATACTGG + Intergenic
1134299990 16:12982220-12982242 GTGGCTACTGGCCACCATATTGG - Intronic
1135080203 16:19427535-19427557 GTGGCTAGTGGCTGCCATATTGG + Intronic
1135171464 16:20187784-20187806 GTGGCTAGTGGCTACCATATTGG + Intergenic
1135502446 16:23008419-23008441 ATGGCCAGTGGCTGCCATATTGG - Intergenic
1137499808 16:49001864-49001886 GTGGCTAATGGCTACCATATTGG - Intergenic
1137611256 16:49819321-49819343 GTGGCTAGTGGCTACCATATTGG + Intronic
1138103492 16:54273754-54273776 GTGGGCAGCGGCTGCCATGTTGG + Intergenic
1138638784 16:58365717-58365739 GTGGCCCCAGCCATCCATATAGG + Intronic
1139351344 16:66338096-66338118 TTAGCCACAGGCTGTCATCTAGG + Intergenic
1139495877 16:67317140-67317162 GTGGCTAGTGGCTACCATATTGG - Intronic
1139661989 16:68427503-68427525 GTGGCTACAGGCTACCATATTGG - Intronic
1140135858 16:72204950-72204972 GTGGTTACTGGCTGCCATATTGG + Intergenic
1140203217 16:72911620-72911642 GTGGCTAGTGGCTGCTATATTGG - Intronic
1140960373 16:79906334-79906356 GTGGCTAGTGGCTCCCATATTGG - Intergenic
1141188443 16:81806191-81806213 GTGGCTAGTGGCTACCATATTGG + Intronic
1141695904 16:85619287-85619309 GTGGCCACAGGCAGCAATGAAGG + Intronic
1142192628 16:88724980-88725002 GTGGCCACAGGCGGCCTAATTGG + Intronic
1142776200 17:2141155-2141177 GTGGCCAGTGGCTACCATAGAGG + Intronic
1143892315 17:10111944-10111966 GTGTCCACTGACTACCATATGGG - Intronic
1143902052 17:10181850-10181872 GTAGCCTCTGGCTGCCATCTTGG - Intronic
1144492448 17:15725389-15725411 TTGGCCACAGGCGGGCATCTGGG - Intergenic
1144573230 17:16413769-16413791 GTGGCTAGTGGCTACCATATCGG - Intergenic
1144824630 17:18098884-18098906 TTGGCCACAGGTTGGCATCTGGG + Intronic
1144908026 17:18653798-18653820 TTGGCCACAGGCGGGCATCTGGG + Intronic
1145788699 17:27610900-27610922 GTGGCAAGAGGCTCCCACATTGG + Intronic
1145899785 17:28483020-28483042 GTGGGGACAGGCTGGCACATGGG - Intronic
1146254477 17:31382754-31382776 GTGGCTACTGGCTGCTAGATTGG + Intergenic
1147102289 17:38186985-38187007 GTGGCCAGAGGCTGACGGATCGG - Intergenic
1147846596 17:43408405-43408427 GTGGCTCATGGCTGCCATATTGG - Intergenic
1148121623 17:45215995-45216017 GTGGCCAGTGGCTGCCATATTGG + Intergenic
1148380185 17:47190854-47190876 GTGGCTAGTGACTGCCATATTGG + Intergenic
1148393851 17:47293015-47293037 GTGGCTAAAGCCTACCATATTGG - Intronic
1149001352 17:51761012-51761034 GTGGCTAGTGGCTGCCATACTGG + Intronic
1149488537 17:57064765-57064787 GTGGCAAGCGGCTACCATATTGG + Intergenic
1150426820 17:65083726-65083748 GTGGCTAGTGGCTACCATATTGG + Intergenic
1150813553 17:68375627-68375649 GTGGCTAGTGGCTACCATATTGG + Intronic
1151381547 17:73729166-73729188 ATGGCCCATGGCTGCCATATTGG - Intergenic
1151680763 17:75621491-75621513 TTGGCCACAGGCTCCCATCCAGG + Intergenic
1153459841 18:5321367-5321389 GTGGGCGTTGGCTGCCATATTGG - Intergenic
1154009273 18:10561370-10561392 GTGGCTACTGGCTACCATTTTGG + Intergenic
1154929546 18:20978571-20978593 GTGGCTACTGGCCACCATATTGG + Intronic
1154955336 18:21248718-21248740 GTGGCTAGAGGCTACCATATTGG - Intronic
1154967161 18:21371174-21371196 GTGGCTAGTGGCTACCATATTGG + Intronic
1155220266 18:23678919-23678941 GTGGCTCTTGGCTGCCATATTGG + Intergenic
1155895158 18:31316093-31316115 GTGGCTAGTGGCTACCATATTGG - Intergenic
1155931548 18:31714086-31714108 GTGGCCTATGGCTACCATATTGG - Intergenic
1155994473 18:32315647-32315669 GTGGCTACTGGCTGTCATACTGG + Intronic
1159336981 18:67081093-67081115 GTGGCTACAGGCTACTATATTGG + Intergenic
1160523633 18:79522904-79522926 GGGGCCCCAGGCCGCCATCTGGG + Intronic
1160537792 18:79604199-79604221 GTGGCCTCACGCTGCCCTCTGGG - Intergenic
1161094264 19:2380085-2380107 GGGGCCAGTGGCTGCCATTTTGG + Intergenic
1161098702 19:2409490-2409512 GTGGCCAGTGGCTACTATATTGG + Intronic
1161271925 19:3394590-3394612 GTGGCCAGGGGCTGCTGTATTGG + Intronic
1161512817 19:4681075-4681097 GTGGCCACTGGCTCCCGTATCGG - Intronic
1161763502 19:6191980-6192002 GTGGCCAGTGGCTGCCATATTGG - Intronic
1161962931 19:7532819-7532841 GTGGCTGGTGGCTGCCATATTGG + Intronic
1162336926 19:10067569-10067591 GTGGCTAATGGCTGCCATACTGG + Intergenic
1162492743 19:11003558-11003580 GTCGCCAGAAGCTGCCCTATTGG - Intronic
1163751728 19:19082100-19082122 GTGGACACAGGCTGTCACAAGGG - Intronic
1164620387 19:29692194-29692216 GTGGCCAGTGGCTAGCATATTGG - Intergenic
1164880469 19:31728421-31728443 GTGGCCTCAGGCTGTGATAGTGG - Intergenic
1165521640 19:36318978-36319000 GTGGCAAGTGGCTGCCTTATTGG - Intergenic
1165792146 19:38499115-38499137 GAGGCCACAGCCTGCCAGGTAGG - Exonic
1166041931 19:40208774-40208796 GTAGCTACTGGCGGCCATATTGG + Intronic
1166244826 19:41517928-41517950 GTGGACACACCCTGCGATATTGG + Intergenic
1166271688 19:41718326-41718348 GTGGCCACTGGCTGAGTTATTGG - Exonic
1166549080 19:43653140-43653162 GTGGCCAGTGGCTACCAGATTGG - Intronic
1166661919 19:44652995-44653017 GTGGCCAGTAGGTGCCATATTGG + Intronic
1167094636 19:47368100-47368122 GTGGCCAGAGGCGGCCGTATTGG + Intronic
1167155860 19:47738636-47738658 GTGGCTAGTGGCTGCCATACTGG + Intronic
1167159209 19:47756406-47756428 GTGCCCACAGGCTGCCCTGGGGG + Intronic
1167181392 19:47906780-47906802 GTGGCCAGAGGCGGCCATATTGG - Intergenic
1167182056 19:47912156-47912178 GTGGCCAGAGGCGGCCGTATTGG - Intergenic
1167182709 19:47917529-47917551 GTGGCCAGAGGCGGCCGTATTGG - Intergenic
1167183378 19:47922880-47922902 GTGGCCAGAGGCGGCCGTATTGG - Intergenic
1167184022 19:47927924-47927946 GTGGCCAGAGGCGGCCGTATTGG - Intergenic
1167184674 19:47933282-47933304 GTGGCCAGAGGCGGCCGTATTGG - Intergenic
1167185345 19:47938637-47938659 GTGGCCAGAGGCGGCCGTATTGG - Intergenic
1167185999 19:47944023-47944045 GTGGCCAGAGGCGGCCGTATTGG - Intergenic
1167186663 19:47949394-47949416 GTGGCCAGAGGCGGCCGTATTGG - Intergenic
1167187314 19:47954782-47954804 GTGGCCAGAGGCGGCCGTATTGG - Intergenic
1167225339 19:48235295-48235317 GTGGCTAGTGGCTGTCATATTGG - Intronic
1167541875 19:50093482-50093504 GTGGCCAGAGGCGGCCGTATTGG + Intergenic
1167543855 19:50108017-50108039 GTGGCCAGAGGCGGCCGTATTGG + Intergenic
1167544529 19:50113371-50113393 GTGGCCAGAGGCGGCCGTATTGG + Intergenic
1167545204 19:50118721-50118743 GTGGCCAGAGGCGGCCGTATTGG + Intergenic
1167545881 19:50124073-50124095 GTGGCCAGAGGCGGCCGTATTGG + Intergenic
1167546558 19:50129408-50129430 GTGGCCAGAGGCGGCCGTATTGG + Intergenic
1167547218 19:50134742-50134764 GTGGCCAGAGGCGGCCGTATTGG + Intergenic
1167661909 19:50800192-50800214 GTGGCCAGTGGCTGCCAGACTGG + Intronic
1167704624 19:51072461-51072483 GTGGCTAACGGCTACCATATTGG + Intergenic
1168262137 19:55201584-55201606 GTGGCTAGTGGCTACCATATTGG + Intronic
1168332060 19:55576398-55576420 GTGGCTGGTGGCTGCCATATTGG - Intergenic
1168505796 19:56933673-56933695 GTGGCCAGTGGCCGCCATGTTGG - Intergenic
925415420 2:3667017-3667039 GTGGCCACTGGCTTCCAGATTGG + Intronic
926188829 2:10712236-10712258 GTGGCCAATGGCTTCCGTATTGG + Intergenic
926216062 2:10905997-10906019 GTGGTCAGTGGCTGCCATGTTGG - Intergenic
926832000 2:16973557-16973579 GTGGCTAGTGGCTGCCAAATAGG + Intergenic
927142570 2:20140179-20140201 GTGGGCACAGGGAGCCATCTTGG - Intergenic
928567428 2:32567547-32567569 GTGGCCAGTAGCTGCCATACTGG + Intronic
930133328 2:47875291-47875313 GTGGCAAGTGGCTACCATATTGG + Intronic
930871641 2:56176942-56176964 GTGACTAGTGGCTGCCATATTGG - Intergenic
931174685 2:59841838-59841860 GTGGCTAGGGGCTACCATATTGG + Intergenic
931181537 2:59906339-59906361 GTAGCATCAGGCTGCCATACTGG - Intergenic
931989427 2:67775082-67775104 ATGGCTAATGGCTGCCATATTGG + Intergenic
932352687 2:71044672-71044694 GTGTCCACAGCATGCGATATTGG + Intergenic
932754421 2:74396645-74396667 GTGGCCAAGGGCTACCATATTGG + Intergenic
935516215 2:104042674-104042696 GTGGCTAGTGGCTACCATATTGG + Intergenic
937621855 2:123997613-123997635 GTGGCAGAAGGCTGCTATATTGG + Intergenic
937969522 2:127538442-127538464 GTGGCTAGTGGCTACCATATCGG + Intronic
937979531 2:127606800-127606822 GTGGCCACAGGCCTCCACACGGG + Intronic
938656094 2:133435734-133435756 GTGGCTAGTGGCTGGCATATTGG + Intronic
939036165 2:137133930-137133952 GTGGCTACTGGCTACCATGTTGG + Intronic
939700302 2:145383454-145383476 GTGGGCACAGGGTGCTATACTGG + Intergenic
939832888 2:147093987-147094009 GTGTCCACATGGTGCCATATGGG + Intergenic
940671661 2:156677016-156677038 GTGGCTAGTGGCTACCATATTGG - Intergenic
940794452 2:158062328-158062350 GTGGCTAGTGGCTACCATATTGG + Intronic
940873433 2:158879024-158879046 GTGTACACAGCCTGCGATATTGG + Intergenic
941104358 2:161335340-161335362 GTGGCTAATGGCTGCCATACTGG - Intronic
941291174 2:163677422-163677444 GTGGCCAGTGGCTGCTATATTGG - Intronic
941533331 2:166694775-166694797 GTGTACACAGTCTGCGATATTGG + Intergenic
941730401 2:168911347-168911369 GTGGCCAGTGGCTACTATATTGG - Intronic
941756459 2:169191745-169191767 GTGGCCACGGGGTGCCTGATAGG + Intronic
943713699 2:191126616-191126638 CTGGCCACAGACTGCCCTCTGGG + Intronic
943814118 2:192229737-192229759 GTGGCTACTGGCTATCATATTGG + Intergenic
944161565 2:196666400-196666422 GTGGCTAATGGCTACCATATTGG - Intronic
945643110 2:212455451-212455473 GTGGCTAGTGGCTACCATATTGG - Intronic
946411898 2:219519695-219519717 GTGGCTATAGGCTGCCGTGTTGG + Intronic
946679548 2:222198815-222198837 GAGGCCAGAAGCTGCCATACTGG - Intergenic
946796413 2:223359013-223359035 GTGGCCAACGGCTACCATATTGG - Intergenic
946994213 2:225372552-225372574 GTGGCCAGTGGCTACCACATTGG - Intergenic
947029220 2:225773795-225773817 GTGGCTAGTGGCTACCATATTGG + Intergenic
947055754 2:226100778-226100800 GTAGCCAGTAGCTGCCATATTGG - Intergenic
947070488 2:226282897-226282919 ATGGTCACAGGCTACCATATTGG + Intergenic
947548776 2:231031663-231031685 GTGGCTAGTGGCTCCCATATTGG - Intergenic
947550414 2:231041561-231041583 GTGCCCACTGCCTGGCATATGGG - Intronic
947922517 2:233890223-233890245 GTGGCCAGTGGCTACCATATTGG + Intergenic
948372719 2:237500366-237500388 GTGGCTAGTGGCTGCCACATGGG - Intronic
1169071580 20:2735983-2736005 GTGGCTATTGGCTACCATATTGG - Intronic
1169181540 20:3573302-3573324 GTGGCTAGTGGCTACCATATCGG - Intronic
1169181547 20:3573411-3573433 GTGGTTACTGGCTACCATATTGG + Intronic
1169345753 20:4826972-4826994 ATAGCCACAGGCTACCAGATTGG + Intergenic
1169610010 20:7368072-7368094 GTGGCCATTGGCTACCATATTGG + Intergenic
1169698113 20:8414810-8414832 GTGGCTAGTGGCTGCCTTATGGG + Intronic
1169730922 20:8784854-8784876 CAAGCCACAGGCTGCCTTATTGG - Intronic
1169819673 20:9696084-9696106 GTGGCCAGTGGCTACCATACTGG + Intronic
1170032507 20:11957741-11957763 GTGGCTGCAGGCTACCATGTTGG + Intergenic
1170204243 20:13781196-13781218 GTGACTACTGGCTACCATATTGG - Intronic
1170458738 20:16556946-16556968 GTGGCTAGTAGCTGCCATATTGG - Intronic
1170636198 20:18106667-18106689 GTGGTTAATGGCTGCCATATCGG - Intergenic
1170879861 20:20287385-20287407 GTGGCTACTGGCTGCCATATTGG - Intronic
1171009311 20:21499670-21499692 GTGGCTAGTGGCTGCCATATTGG + Intergenic
1172634541 20:36401110-36401132 TTGGCCTCAGGCTGCCCAATTGG - Intronic
1172871327 20:38137138-38137160 GTGGCCAGAAGCTGCTATGTTGG - Intronic
1173361111 20:42345137-42345159 GTGGCTACTGACTGCCATTTTGG - Intronic
1173392366 20:42646515-42646537 ATGGCCAATGGCTACCATATTGG - Intronic
1173745107 20:45430407-45430429 GTGGTCAGTGGCTACCATATTGG + Intergenic
1173980584 20:47220891-47220913 GTGGCTAGTGGCTGCCCTATTGG - Intronic
1174035239 20:47664666-47664688 GTGGCCAGTGGCTACCATACTGG - Intronic
1174078608 20:47955438-47955460 GTGGCTAGCGGCTGCTATATTGG + Intergenic
1174580053 20:51564898-51564920 GTGGCTAGTGGCTGCCATATCGG - Intergenic
1174622509 20:51886833-51886855 GTGGCTAGTGGCTACCATATTGG - Intergenic
1174725473 20:52857122-52857144 GTGGCTAGCGGCTACCATATTGG - Intergenic
1175149523 20:56922181-56922203 GGGGCTAATGGCTGCCATATTGG - Intergenic
1175298197 20:57923760-57923782 ATGGCCACAGGGAGCCATCTGGG - Intergenic
1175653631 20:60750280-60750302 TAGGCCAGAGGCTGCCATGTTGG - Intergenic
1175818441 20:61895840-61895862 GTGTCCCCAGGCTGTCATTTTGG + Intronic
1178709283 21:34900312-34900334 GTGGCTAGTGGCTACCATATTGG + Intronic
1178987715 21:37322425-37322447 GTGGCTAGTGGCTACCATATTGG - Intergenic
1179169564 21:38962447-38962469 GAGGCCACAGGCTGCTGCATGGG - Intergenic
1179623983 21:42637923-42637945 GTGGGGGCAGGCTGCCCTATTGG - Intergenic
1181842074 22:25671803-25671825 CTGGCTACTGGCTACCATATTGG - Intronic
1181880269 22:25973673-25973695 GTGGCTAGTGGCTACCATATTGG + Intronic
1181961353 22:26624112-26624134 GTGGCCAGTAGCTACCATATTGG + Intronic
1181961360 22:26624174-26624196 GTGGCCAGTAGCTACCATATTGG + Intronic
1181961374 22:26624303-26624325 GTGGCCAGTAGCTTCCATATTGG + Intronic
1181961382 22:26624368-26624390 GTGGCCAGTAGCTACCATATTGG + Intronic
1181961389 22:26624433-26624455 GTGGCCAGTAGCTACCATATTGG + Intronic
1182171906 22:28239270-28239292 GTGGCTATTGGCTACCATATTGG - Intronic
1182733595 22:32514525-32514547 GTTGCTACAGGCTGGCATTTAGG - Intronic
1183521207 22:38297122-38297144 GTGGCCAATGGCTACCATCTTGG + Intronic
949902201 3:8825147-8825169 GTGGCTAGTGGCTACCATATTGG + Intronic
950155069 3:10715866-10715888 GTGGCTAGTGGCTACCATATTGG - Intergenic
950667964 3:14508641-14508663 GTGGCTGGTGGCTGCCATATTGG - Intronic
951221291 3:20071258-20071280 GTGGCCAGAGGCTACCGTACTGG + Intronic
951678922 3:25274342-25274364 ATGGCCATAGGCTACCATACAGG + Intronic
952018019 3:28982470-28982492 GTGGCCAGTGGCTGCCCTATGGG - Intergenic
952234564 3:31465435-31465457 GTGGCTAGTGGCTACCATATCGG + Intergenic
952280116 3:31914826-31914848 GTGGCTACTGGCTACCATATTGG + Intronic
952338744 3:32427621-32427643 GAGGCCATGGGCTGCCATATTGG + Intronic
952810831 3:37401158-37401180 GGGGAGACAGGCTGCCATAGAGG - Intronic
952829842 3:37555361-37555383 GTGGTCACTGGCCACCATATTGG - Intronic
953621870 3:44540022-44540044 GTGGCTAGTGGCTACCATATTGG - Intergenic
953727916 3:45416741-45416763 GTGGCTACTGGCTACCATATTGG + Intronic
953774388 3:45803072-45803094 GTGGCTAGTGGCTACCATATCGG - Intergenic
953959928 3:47258956-47258978 GTGGCCAGTGGCTGCCATAGTGG + Intronic
954431332 3:50472394-50472416 GAGGCCACAGGCTACCCTCTGGG - Intronic
955112758 3:55965402-55965424 GTGGCTAATGGCTGCCCTATTGG + Intronic
955583602 3:60451906-60451928 GTGGCCTCAGGGTCCCATGTGGG - Intronic
955636307 3:61033320-61033342 GTGGCCAGTGGCTACTATATTGG - Intronic
955976290 3:64483566-64483588 GTGGCCAGTGGCTACCGTATTGG - Intergenic
956021611 3:64939306-64939328 GTGGCTAGTGGCTACCATATTGG + Intergenic
956191502 3:66612522-66612544 GTGGCTAGTGGCTACCATATTGG - Intergenic
956982752 3:74657989-74658011 GTGGCTCGAGGCTACCATATTGG - Intergenic
957321526 3:78637590-78637612 GTTGCCAATGGCTACCATATTGG + Intronic
958055663 3:88407575-88407597 GTGGTGACAGGTGGCCATATAGG + Intergenic
958728089 3:97930725-97930747 GTGGCTAGTGGCTGCCATATTGG + Intronic
958889902 3:99771807-99771829 GTGTCCATATGGTGCCATATGGG + Intronic
958947236 3:100377432-100377454 GTAGCCACTGCCTACCATATTGG - Intronic
958949826 3:100404389-100404411 GTGGCTAGTGGCTACCATATTGG - Intronic
960073251 3:113455389-113455411 ATAGCTAGAGGCTGCCATATTGG - Intronic
960789371 3:121411218-121411240 GTGGTTACTGGCTACCATATTGG + Intronic
961371300 3:126433606-126433628 GTGGCCCCAGGCTGTCAGGTTGG - Intronic
961944777 3:130674289-130674311 GTGGCTCATGGCTGCCATATAGG + Intronic
962493978 3:135921291-135921313 GTGGCCAGTGGCTGCCATATTGG + Intergenic
963847013 3:150169889-150169911 GTGGCTAGTGGCTGCCATGTTGG + Intergenic
964840304 3:160986323-160986345 GAGCCCAGAGGCTCCCATATTGG + Intronic
964874574 3:161351884-161351906 GTGACTAGTGGCTGCCATATTGG - Intronic
966696681 3:182796508-182796530 GCTGCCATTGGCTGCCATATTGG + Intronic
969522256 4:7685286-7685308 GTGGCCTCAGGCAGGCATGTGGG + Intronic
969792816 4:9503644-9503666 GTGTCCACTTTCTGCCATATAGG + Intergenic
969931986 4:10639738-10639760 GTGGCAAACGGCTACCATATTGG + Intronic
971130929 4:23809782-23809804 GTGGCTAAAGGCTACCATATTGG + Intronic
971252174 4:24982444-24982466 GTGGCCAGTAGCTTCCATATTGG - Intergenic
971522087 4:27566792-27566814 GTGGCTAGTGGCTACCATATGGG - Intergenic
972239641 4:37176471-37176493 GTGGCAAGTGGCTACCATATTGG + Intergenic
972292464 4:37702653-37702675 GTGGCTAGTGGCTGCCACATGGG + Intergenic
972412724 4:38809181-38809203 TTGGCCAGAGACTACCATATTGG + Intronic
972645635 4:40965447-40965469 GTGGCCACTGACTCCCCTATTGG - Intronic
972671730 4:41218832-41218854 GTGGCTAGTGACTGCCATATTGG - Intergenic
973066210 4:45796414-45796436 GTGGCTAGTGGCTGTCATATTGG - Intergenic
974587353 4:63896452-63896474 AAGTCCACAGGCTGCCACATTGG + Intergenic
978296477 4:107211091-107211113 GTGGCCACAGGCTGCAGCACTGG + Intronic
978718944 4:111882383-111882405 GTGGCCAGTGGCTACCATGTTGG - Intergenic
980028185 4:127791536-127791558 GTGGCTAGTGGCTGCCATATGGG + Intronic
980161221 4:129165258-129165280 GTGGCCAGTGGCTACCATTTTGG - Intergenic
980493983 4:133568274-133568296 GTGGCAAATGGCTACCATATTGG - Intergenic
980832515 4:138149188-138149210 GTGGCTACTGGCTACCATACTGG - Intergenic
980977099 4:139621874-139621896 GTGGCTAGTGGCTACCATATTGG + Intergenic
983282986 4:165704827-165704849 ATGGCCAATGGCTACCATATTGG - Intergenic
984156010 4:176196868-176196890 GTGGCTAGTGGCTACCATATTGG - Intergenic
984250708 4:177330905-177330927 GTGGGTAGTGGCTGCCATATTGG + Intronic
984708351 4:182864005-182864027 GTGGACACAGGCTGCTTTAAAGG + Intergenic
984791669 4:183620422-183620444 GTGGCTAGTGGCTGCCTTATTGG - Intergenic
985121419 4:186646451-186646473 GTGGCCAGGTGCTACCATATTGG - Intronic
985801116 5:2005762-2005784 GCGGCCACGGGCTGCCATCCTGG + Intergenic
987940748 5:24532522-24532544 TTGGCTAGTGGCTGCCATATTGG - Intronic
988090658 5:26537028-26537050 GTGACCACAAGCTACCATTTTGG - Intergenic
988341021 5:29972082-29972104 GTGGCTAGTGGCTACCATATTGG + Intergenic
988514106 5:31890240-31890262 GTGGCTAGTGGCTGCCGTATTGG - Intronic
988916276 5:35896581-35896603 GTGGCTAGTGGCTACCATATTGG - Intergenic
989244242 5:39235901-39235923 GTGGTCAGTGGCTACCATATTGG - Intronic
990227405 5:53670323-53670345 GTGGCCAGTGGCTACCATATTGG - Intronic
990294468 5:54386613-54386635 GCAGCAACAAGCTGCCATATTGG + Intergenic
990333307 5:54748378-54748400 GTAGCCAGGGGCTGCCATGTGGG + Intergenic
990516223 5:56533250-56533272 GTGGCTAGTGGCTACCATATTGG - Intronic
990642862 5:57807314-57807336 GTGGCTAGTGGCTACCATATGGG - Intergenic
990968336 5:61474659-61474681 GTGGCTAGTGGCTGCCATATTGG + Intronic
991722721 5:69508676-69508698 GTGGCTAGTGGCTGCCACATTGG + Intronic
991732763 5:69605091-69605113 GCGGACACAGGATGCCAGATAGG + Intergenic
991809196 5:70460235-70460257 GCGGACACAGGATGCCAGATAGG + Intergenic
991862190 5:71022761-71022783 GCGGACACAGGATGCCAGATAGG - Intronic
992126490 5:73647661-73647683 GTGGCAAGTGGCTACCATATTGG + Intronic
992141099 5:73797906-73797928 GTGGCCACAGGCTACTACACTGG - Intronic
994133757 5:96261803-96261825 GTGGCTAGCGGCTGCCATATTGG + Intergenic
994366700 5:98925804-98925826 GTGGCTAGTGGCTACCATATTGG - Intronic
994391478 5:99197429-99197451 GTGGACACCCTCTGCCATATTGG + Intergenic
995067594 5:107879844-107879866 GTGGCCACAGACTGCCCCCTGGG + Intronic
997705524 5:135948417-135948439 GTGGCTAGTGGCTACCATATTGG - Intronic
998375455 5:141687592-141687614 GTGGCTACCGGCTGCCATACTGG - Intergenic
998480132 5:142456226-142456248 TTGTCCACAGGCAGCCAAATAGG + Intergenic
998736089 5:145142979-145143001 TTGGTGACAGGGTGCCATATGGG + Intergenic
999059728 5:148620443-148620465 GTGGCTAGTGGCTACCATATCGG - Intronic
1000299304 5:159941238-159941260 GTGGCTAGTGACTGCCATATTGG + Intronic
1001224218 5:169929875-169929897 GTGGCTAGTGGCTACCATATTGG - Intronic
1002287817 5:178176883-178176905 GTGGCCACAAGGTGCCAAATTGG - Intergenic
1003221294 6:4163231-4163253 ATGGCCACATGCTTCCATCTGGG - Intergenic
1003507833 6:6754041-6754063 GTTGCTAGTGGCTGCCATATTGG - Intergenic
1003788170 6:9511284-9511306 GTGGCTAGTGGCTACCATATTGG + Intergenic
1003924959 6:10869109-10869131 ATGGCCAGTGGCTACCATATTGG + Intronic
1005195547 6:23279393-23279415 GTGGCTAGTGGCTACCATATTGG + Intergenic
1006021826 6:31121816-31121838 GTGGCCAGTGGCTACCGTATCGG - Intronic
1007921539 6:45614662-45614684 GTGGCTAGTGGCTGCCGTATTGG + Intronic
1007943355 6:45802769-45802791 GTGGCCGCTGGCTACCATATTGG - Intergenic
1007967776 6:46017849-46017871 GGGGACACAGCCTGCCATAAAGG - Intronic
1008064158 6:47029844-47029866 GTGGCCAGGGGCTACCATATTGG + Intronic
1008068002 6:47071157-47071179 GTGGCTAATGGCTACCATATTGG - Intergenic
1009228003 6:61035213-61035235 GTGTCCACTTGCTGCGATATTGG + Intergenic
1009243940 6:61211648-61211670 GTGGCCACAAGGTACCAAATTGG - Intergenic
1011123014 6:83975397-83975419 GTGGCCACAAGGTACCAAATTGG - Intergenic
1011142652 6:84177138-84177160 GTGGCCAGTGGCTGCCACAGTGG + Intronic
1011441996 6:87397467-87397489 GTGGCTAGAGGCTACCGTATTGG - Exonic
1011461765 6:87612792-87612814 GTAGACACAGGGTACCATATTGG + Intronic
1011704079 6:89983716-89983738 GTGGCTACTGGCTACCATATTGG + Intronic
1011772559 6:90691180-90691202 GTGGTTAATGGCTGCCATATTGG - Intergenic
1013055266 6:106576672-106576694 GTGTCTAGAGGCTACCATATTGG - Intronic
1013361227 6:109395487-109395509 GTGGCCAGTGGCTGTCATACTGG + Intronic
1013370262 6:109463448-109463470 GTGGCTAGTGGCTGCTATATTGG - Exonic
1016016477 6:139191492-139191514 GTGGCTAGTGGCTACCATATTGG + Intergenic
1017222524 6:151983103-151983125 GTGGCCAGTGGCTATCATATTGG + Intronic
1017313313 6:153000413-153000435 GTGGCTACTGGCTACTATATTGG + Intronic
1017469922 6:154729589-154729611 GTGGCTAGTGGCTACCATATTGG - Intergenic
1018376080 6:163214267-163214289 GTGGCTAGTGGCTACCATATTGG + Intronic
1019005067 6:168789952-168789974 GTGGCCACAGGCTGCAAGCAAGG - Intergenic
1019030834 6:169009425-169009447 GTGGCCATACGATGCAATATGGG - Intergenic
1019289339 7:242744-242766 GTGGCCACTGGCTGCCGAGTTGG + Intronic
1019332888 7:469615-469637 GTGGCCGGTGGCTGCCATGTTGG + Intergenic
1019795846 7:3047857-3047879 GTGGCCAGTGGCTGTCACATTGG - Intergenic
1019915780 7:4131393-4131415 GAGGCCACAGGCTCCCAACTAGG - Intronic
1020261390 7:6532382-6532404 GTACCCACAGGCTGCCCCATGGG - Intronic
1020383571 7:7571962-7571984 GTGGCTAGTGGCTACCATATTGG + Intronic
1020422111 7:8019221-8019243 GTGGCTACCGGCTGTCATATAGG - Intronic
1021461516 7:20892402-20892424 GTGGCTAGTGGCTACCATATTGG + Intergenic
1021496259 7:21277672-21277694 GTGGCTAGTGGCTACCATATTGG + Intergenic
1021514000 7:21463031-21463053 GTGGCAAGAGGCTATCATATTGG + Intronic
1021699311 7:23302041-23302063 GTGGCTAATGGCTACCATATGGG + Intronic
1021972790 7:25981793-25981815 GTGGCCAGTGGCTGCCATATTGG - Intergenic
1022311629 7:29201697-29201719 ATGGCCAGTGGCTACCATATTGG + Intronic
1023045450 7:36206495-36206517 GTGGCTTATGGCTGCCATATTGG + Intronic
1023272118 7:38475047-38475069 GTGGCTAGTAGCTGCCATATAGG - Intronic
1023848376 7:44136504-44136526 GTGGCCAGTGGCTGTCATATTGG + Intergenic
1023900768 7:44476787-44476809 GTGGGCACAGCCAGCCATAAAGG + Intronic
1023970176 7:44985207-44985229 GTGGCCAGTGGCTACCATATTGG - Intergenic
1024542353 7:50487653-50487675 GTGGCCACAAGGTACCAAATTGG + Intronic
1024584621 7:50831265-50831287 GTGACCATTGGCTACCATATTGG + Intergenic
1025016771 7:55445763-55445785 GTGGCTAGTGGCTACCATATTGG - Intronic
1026571060 7:71531410-71531432 GTGGCTAGTGGCTACCATATTGG + Intronic
1027667814 7:81060773-81060795 GTGGCTAGTGGCTACCATATTGG + Intergenic
1029652402 7:101902517-101902539 GTGGCCACTGGCTACCATTTTGG + Intronic
1029843585 7:103390829-103390851 GTGGCTACTGGCTCCCATATTGG - Intronic
1029843642 7:103391239-103391261 GTTGCTAGTGGCTGCCATATTGG + Intronic
1029987761 7:104937196-104937218 GTGGCCAGTGGTTGCCATAATGG - Intergenic
1030041202 7:105451852-105451874 GTGGCCAATGGCTACCACATTGG - Intronic
1030112878 7:106041468-106041490 GTGGCCACAGGGTGGAATCTTGG - Intergenic
1031478408 7:122249859-122249881 GTGGCTAGAAGCTACCATATTGG - Intergenic
1032166831 7:129552159-129552181 GTGGCCAGGGGCTGCCTGATAGG + Intergenic
1032261854 7:130344607-130344629 GTGGCTAATGGCTACCATATTGG - Intergenic
1032338768 7:131051294-131051316 GTGGCCAGTTGCTACCATATTGG + Intergenic
1032488222 7:132304625-132304647 GTGGCCAGAGGCTACCATATTGG + Intronic
1032954772 7:136958338-136958360 GTGCCCACAGGCTCCCATCATGG - Intronic
1033488131 7:141812018-141812040 TTGGCCACAGCCTGCAACATGGG - Intergenic
1034004769 7:147459091-147459113 GTGGCTAGAGGCTACCATATTGG - Intronic
1034504465 7:151476283-151476305 GTGGCTGGAGGCTGCCATGTTGG - Intronic
1035063326 7:156086200-156086222 GTGACCAGCAGCTGCCATATTGG - Intergenic
1035193190 7:157190506-157190528 GTGGCCAGGGGCTACCTTATTGG + Intronic
1036915930 8:12803628-12803650 GTGGCCAGTGGTTACCATATTGG - Intergenic
1037732924 8:21543837-21543859 ATGGCTAGTGGCTGCCATATTGG + Intergenic
1037742600 8:21619516-21619538 GTGCCAAGTGGCTGCCATATTGG + Intergenic
1038357416 8:26842281-26842303 GTGGCTAGAGGCTACCATATTGG + Intronic
1038702342 8:29860409-29860431 GTGACCACTGGCTACCAAATTGG - Intergenic
1039980835 8:42408771-42408793 GTGGCCAGTGGCTACTATATTGG + Intergenic
1041697830 8:60755980-60756002 GTGGCTAGTGGCTACCATATTGG - Intronic
1042144837 8:65716910-65716932 GTGGCTAGTGGCTACCATATTGG - Intronic
1042723470 8:71848163-71848185 GTGGCTAATGGCTTCCATATTGG - Intronic
1042813857 8:72856369-72856391 GTTGCTAGTGGCTGCCATATTGG + Intronic
1043958636 8:86390298-86390320 CTGGGCACAGGCTGCAATCTCGG + Intronic
1045127637 8:99110515-99110537 GTGGCTAGTGGCTACCATATTGG - Intronic
1046378116 8:113414144-113414166 GTGGCCAGTGGCTACCATATTGG - Intronic
1046542816 8:115608720-115608742 GTGGCTAGTGGCTACCATATTGG - Intronic
1046946658 8:119980354-119980376 GTGGCTAGTGGCTGCCATCTTGG + Intronic
1047224826 8:122947476-122947498 GTGGCCAGTGGCTACCATATTGG + Intronic
1047742915 8:127821250-127821272 GTGGCTAGCGGCTACCATATGGG - Intergenic
1048535785 8:135292861-135292883 ATGACCATAGTCTGCCATATCGG + Intergenic
1049408945 8:142463989-142464011 GTGGCCACAGGCTGGCACCAGGG + Exonic
1049467231 8:142757121-142757143 TTGGCCACAGCCTCCCACATGGG - Intergenic
1049932029 9:466738-466760 GGGGCCACTGGCTACCATATTGG + Intergenic
1050297328 9:4218740-4218762 GTGGCTAATGGCTACCATATTGG + Intronic
1051396028 9:16621693-16621715 GTGGCTAGTGGCTACCATATTGG - Intronic
1051660496 9:19421865-19421887 GTGGCCAGTGACTGTCATATTGG - Intronic
1053189980 9:36056616-36056638 GTGGCTAGTGGCTACCATATAGG - Intronic
1054724121 9:68633525-68633547 GTGGCCAGTGGCTACCATATGGG + Intergenic
1055095200 9:72406155-72406177 GTAGCTAAAGGCTGCCATATTGG - Intergenic
1055139134 9:72855595-72855617 ATGGCTAGTGGCTGCCATATTGG - Intergenic
1055747122 9:79460704-79460726 GTGGCTAGTGGCTACCATATTGG - Intergenic
1056099770 9:83290195-83290217 GTGGCTGGTGGCTGCCATATTGG - Intronic
1056232463 9:84560613-84560635 GTGGCTGGTGGCTGCCATATTGG + Intergenic
1056279505 9:85027578-85027600 GTGGGTAGAGGCTACCATATTGG - Intergenic
1056782937 9:89564916-89564938 GAGGCCAGAGACTGGCATATTGG + Intergenic
1057709552 9:97426947-97426969 GTGGCCACTGGCTACCATACTGG - Intronic
1058488186 9:105463552-105463574 GTGGCTAGTGGCTACCATATTGG + Intronic
1058613680 9:106802785-106802807 GTGGCCAGTGGCTCCCATATTGG + Intergenic
1058758950 9:108110838-108110860 GTGGCTAGTGGCTGCCATACTGG - Intergenic
1058890529 9:109356928-109356950 GTGGCTAGTGGCTACCATATTGG + Intergenic
1058915095 9:109557904-109557926 GTGGCTAGGGGCTGCCATACTGG + Intergenic
1058958964 9:109974913-109974935 TTGGCCAGAGGCTCCCCTATGGG - Intronic
1060302379 9:122382645-122382667 GTGGCTAGTGGCTACCATATTGG + Intronic
1060756033 9:126214428-126214450 GTAGCTAGGGGCTGCCATATTGG - Intergenic
1060862826 9:126969466-126969488 GTGGCTAGTGGCTACCATATTGG + Intronic
1061074196 9:128331249-128331271 GTGGCAAGCGGCTGCCATACTGG + Intronic
1061505158 9:131027669-131027691 GTGGCCAGTGGCTGCCACGTTGG + Intronic
1061679035 9:132233595-132233617 GGGGCCACTGGCTGTCACATTGG - Intronic
1062110567 9:134779941-134779963 GAGGCCACAGGGGGACATATGGG + Intronic
1062437958 9:136555131-136555153 GTGGCCACAGGCAGGCAGAGGGG - Intergenic
1062524878 9:136974144-136974166 GTGGCCAGAGGCAGCCAGAAAGG + Intergenic
1185525778 X:777810-777832 GTGGCTGCAGGCTGACTTATAGG + Intergenic
1185619212 X:1443074-1443096 GTGGACACACACTGCCATCTGGG + Intronic
1185619219 X:1443131-1443153 GTGGACACACGCCGCCATCTTGG + Intronic
1185619229 X:1443188-1443210 GTGGACACACACTGCCATCTGGG + Intronic
1185619271 X:1443473-1443495 GTGGACACATGCCGCCATCTTGG + Intronic
1185619304 X:1443689-1443711 GTGGACACACACTGCCATCTTGG + Intronic
1185619314 X:1443752-1443774 GTGGACACACACTGCCATCTTGG + Intronic
1186062418 X:5724096-5724118 GTGGCTAGTGGCTACCATATTGG + Intergenic
1186340241 X:8637553-8637575 GTGGCTGCTGGCTGCCATATTGG - Intronic
1186709666 X:12180146-12180168 GTGGCTAGTGGCTACCATATTGG - Intronic
1186882714 X:13882212-13882234 GTGGCCAGCGGCTACCATGTTGG - Intronic
1186882819 X:13883380-13883402 GTGGCCAGCGGCTACCATGTTGG - Intronic
1187135174 X:16541067-16541089 GTGGCCAGTGGCTACCATATTGG - Intergenic
1187142942 X:16611633-16611655 GTGGCTAGTGGCTACCATATTGG + Intronic
1187254089 X:17626131-17626153 ATGGCTAGGGGCTGCCATATTGG + Intronic
1187300744 X:18047175-18047197 GTGGCTAGTGGCTGCCACATTGG + Intergenic
1187334435 X:18369918-18369940 ATGGCTAGTGGCTGCCATATTGG + Intergenic
1187376209 X:18757150-18757172 GTGGCTAGTGGCTGCCATATTGG + Intronic
1187425015 X:19169734-19169756 GTGGCTAGTGGCTACCATATTGG - Intergenic
1187556371 X:20356268-20356290 GTGGCCAGTGGCTACCATATTGG + Intergenic
1187688771 X:21842480-21842502 GTGGCTAATAGCTGCCATATTGG - Intronic
1188127022 X:26381507-26381529 GTGACTACTGGCTACCATATTGG + Intergenic
1188350434 X:29123729-29123751 GGGGCCAGTGGCTACCATATTGG - Intronic
1188944157 X:36277760-36277782 GTGGCTAGTGGCTACCATATTGG + Intronic
1189256463 X:39643545-39643567 GTGGCTAGTGGCTACCATATTGG + Intergenic
1189256953 X:39647603-39647625 ATGGCTACTGGCTACCATATTGG - Intergenic
1189388735 X:40558228-40558250 GTGGACACAGGCATGCATATAGG - Intergenic
1190585775 X:51939790-51939812 GTGGCCAGTGGCAACCATATTGG + Intergenic
1192407834 X:70904677-70904699 GTGGCTAGTGGCTACCATATTGG - Intronic
1192593369 X:72380992-72381014 GTGGCTACTGGTTACCATATTGG + Intronic
1193384378 X:80853491-80853513 GTGGCCACAAGGTACCAAATTGG - Intergenic
1194503992 X:94710066-94710088 GTGGCCACAAGGTACCATATTGG + Intergenic
1195454070 X:105048642-105048664 GTGGCCAGTAGCTGCCATAGTGG + Intronic
1195997006 X:110741579-110741601 GTGGCCACTGGCTGCCCTCTGGG + Intronic
1196565582 X:117200500-117200522 GTGGCTAGTGGCTACCATATTGG - Intergenic
1196724409 X:118883293-118883315 GTGGCTACTGGCTACCCTATTGG + Intergenic
1197085523 X:122469434-122469456 GTGGCTAGTGGCTACCATATAGG + Intergenic
1197172377 X:123448689-123448711 GTGGCTAGAAGCTACCATATTGG + Intronic
1197483257 X:127013735-127013757 GTGGCCAGTGACTACCATATTGG + Intergenic
1198053634 X:132972870-132972892 GTGGCTGCTGGCTGCCATACTGG + Intergenic
1198203329 X:134443500-134443522 GTGGCTAGTGGCTGCTATATTGG + Intergenic
1200698281 Y:6380470-6380492 ATGGCCCCTGGCTGTCATATTGG + Intergenic
1200835507 Y:7727656-7727678 GTGGCCACAGGATAGCATAAAGG + Intergenic
1200836382 Y:7736113-7736135 GTGGCTAGTGGCTGCCATATTGG - Intergenic
1201035833 Y:9784229-9784251 ATGGCCCCTGGCTGTCATATTGG - Intergenic
1201408183 Y:13670745-13670767 GTGGCCACAAGTTACCAAATTGG - Intergenic