ID: 1112217363

View in Genome Browser
Species Human (GRCh38)
Location 13:97446889-97446911
Sequence GATGCTGTGGGTCAACAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 464
Summary {0: 1, 1: 1, 2: 12, 3: 89, 4: 361}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112217363_1112217368 21 Left 1112217363 13:97446889-97446911 CCAAATTGTTGACCCACAGCATC 0: 1
1: 1
2: 12
3: 89
4: 361
Right 1112217368 13:97446933-97446955 ATTTTAAGCCCCTAAGTTTTGGG 0: 2
1: 33
2: 275
3: 1234
4: 3191
1112217363_1112217367 20 Left 1112217363 13:97446889-97446911 CCAAATTGTTGACCCACAGCATC 0: 1
1: 1
2: 12
3: 89
4: 361
Right 1112217367 13:97446932-97446954 TATTTTAAGCCCCTAAGTTTTGG 0: 2
1: 48
2: 297
3: 1027
4: 2202
1112217363_1112217366 -4 Left 1112217363 13:97446889-97446911 CCAAATTGTTGACCCACAGCATC 0: 1
1: 1
2: 12
3: 89
4: 361
Right 1112217366 13:97446908-97446930 CATCATGCAATATAGTAAAATGG 0: 1
1: 1
2: 1
3: 34
4: 299

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112217363 Original CRISPR GATGCTGTGGGTCAACAATT TGG (reversed) Intronic
901858321 1:12058253-12058275 GTTTCTGTGAGTCAGCAATTTGG - Intergenic
901906007 1:12411662-12411684 AATTCTGTGGGTTAATAATTTGG + Intronic
902154260 1:14471136-14471158 GTTTCTGTGGGTCAAGAATTTGG - Intergenic
902263024 1:15241100-15241122 GATTCTGTGGGTCAGGAATTGGG - Intergenic
903704868 1:25278448-25278470 GATTCTGTGGTGCAACAACTGGG + Intronic
903722363 1:25414873-25414895 GATTCTGTGGTGCAACAACTGGG - Intronic
905039084 1:34938362-34938384 GATTCTGTGGGTCAGAATTTAGG - Intergenic
905801294 1:40844844-40844866 GATTCTGTGGGTCAGCAATTTGG + Intergenic
907196599 1:52692224-52692246 GTTTCTGTGGGTCAAGAATTTGG - Intronic
907654912 1:56332541-56332563 GAGCCTGTGGGTCATTAATTTGG - Intergenic
908105600 1:60838592-60838614 GATTCTGTGGGTTGGCAATTTGG - Intergenic
909032904 1:70562458-70562480 GATTCCGTGGGTAAAGAATTTGG + Intergenic
909239788 1:73197710-73197732 GTTGCTGAGGGCCAAGAATTTGG + Intergenic
910328407 1:86038943-86038965 GTTTCTGTGGGTCAGGAATTTGG - Intronic
912096230 1:106148243-106148265 GATTCTGTAGGTCAAGAATTTGG - Intergenic
912331617 1:108825240-108825262 GTTTCTGTGGGTCAGGAATTTGG - Intronic
912358906 1:109078371-109078393 GTTTCTGTGGGTCAGCAATGTGG + Intergenic
912526597 1:110287889-110287911 GATGCTTTGGGCCAACAATGGGG + Intergenic
912868804 1:113284497-113284519 TATTCTGTAGGTCAACAGTTGGG + Intergenic
913404922 1:118479529-118479551 AGTCCTGTGGGTCAACAATTTGG - Intergenic
913501330 1:119475291-119475313 GTTGCTGTGGGTCAACAGTGTGG + Intergenic
913580886 1:120225729-120225751 GATTTTGTGGGTCAGTAATTTGG + Intergenic
913627293 1:120672670-120672692 GATTTTGTGGGTCAGTAATTTGG - Intergenic
914562818 1:148837167-148837189 GATTTTGTGGGTCAGTAATTTGG + Intronic
914610011 1:149293055-149293077 GATTTTGTGGGTCAGTAATTTGG - Intergenic
916100111 1:161387447-161387469 GATTCTGTGGGTCAAGAATTCGG - Intergenic
916917732 1:169427797-169427819 GAAGCTGAGGGTCAAAAATATGG - Intronic
917018207 1:170558471-170558493 GGTTCTGTGGGTCAGCAATTTGG + Intergenic
917343573 1:174005329-174005351 AATTCTGTGAGTCAGCAATTTGG - Intronic
919346501 1:196386290-196386312 GTTTCTGTGGGTCAGGAATTTGG - Intronic
919869771 1:201811568-201811590 AAGGCTGTGGGTCAGCACTTGGG - Intronic
920168880 1:204057243-204057265 GTTTCTGTGGGTCAGGAATTTGG + Intergenic
922531234 1:226346919-226346941 GCTTCTGTGGGTCAGGAATTTGG + Intergenic
922699542 1:227750737-227750759 GAGGCTGTGGGTGCACAATGTGG + Intronic
923558166 1:235018180-235018202 GATTCTGTGGGTCAGGAATTTGG + Intergenic
923754167 1:236775027-236775049 CTTGCTGAGGGTCAAGAATTAGG + Intergenic
924111063 1:240700533-240700555 GGTGCTGTGGTTCAGCACTTTGG + Intergenic
924181501 1:241443365-241443387 GATTCTATGGGTCAGCAATTTGG + Intergenic
924214156 1:241803027-241803049 GACTCTGTGGGTCAGCAATGTGG + Intergenic
924260547 1:242225950-242225972 GACGCTTTGGGTAAACAGTTTGG - Intronic
1063908838 10:10809054-10809076 GAGGCTGTGGGGAAATAATTAGG + Intergenic
1065683008 10:28256254-28256276 GATGCTGTAGCTAAACCATTAGG + Intronic
1066391180 10:34978473-34978495 GCTGCTGGGGGTAAACCATTAGG + Intergenic
1067530883 10:47071932-47071954 GATTCTGTGGATTAAGAATTGGG + Intergenic
1067971436 10:50975397-50975419 GATTCGGAGGGTCAGCAATTTGG + Intergenic
1068458474 10:57292823-57292845 AATTTTGTGGGTCAATAATTTGG + Intergenic
1069071757 10:63996840-63996862 CATTCTGTGGGTCAGGAATTTGG + Intergenic
1069180316 10:65350945-65350967 GATTCTGTGGGTCAGGAATTTGG + Intergenic
1069700895 10:70424986-70425008 GTTTCTGTGGGTTAAGAATTTGG + Exonic
1071160900 10:82743891-82743913 TGTTCTGTGTGTCAACAATTAGG + Intronic
1071915403 10:90289568-90289590 GATTCTGTAGATCAATAATTTGG - Intergenic
1071925226 10:90399328-90399350 AATGCCTTGGGTGAACAATTGGG + Intergenic
1071985362 10:91044924-91044946 GATTCTGTGGGGCAAGAATTTGG + Intergenic
1072943827 10:99791536-99791558 GTTTCTGTGGATCAAGAATTTGG + Intronic
1073775943 10:106786232-106786254 GATTTTGTGGGTCAGGAATTTGG + Intronic
1074207425 10:111296060-111296082 GATACTGTGGGTCAGGAATGGGG - Intergenic
1074229049 10:111515541-111515563 AATTCTGTGGGTCAGCAATTGGG - Intergenic
1074277924 10:112022569-112022591 GATGCTGAAGGTCAGGAATTTGG - Intergenic
1075115731 10:119625956-119625978 GTTTCTGTGGGTCAGGAATTTGG + Intergenic
1075532802 10:123244337-123244359 GTTTCTGTGGGTCAGGAATTTGG + Intergenic
1075948650 10:126458891-126458913 GATGCTGAGGGTCAGCCACTTGG + Intronic
1076705591 10:132299673-132299695 GATGCTGTGGGCTAGGAATTTGG - Intronic
1078057993 11:8022976-8022998 GATTCTGTGGATCAGCAATTTGG + Intronic
1078825602 11:14927327-14927349 GATTCTGTGGGTCAGGAATTTGG + Intronic
1078881391 11:15452480-15452502 GTTTCTGTGGGTCAGCAATTTGG + Intergenic
1079052273 11:17172512-17172534 GATTCTGTGGGTTATCAATTTGG - Intronic
1080083019 11:28243910-28243932 GATTTTGTGGGTCAGAAATTTGG + Intronic
1080158658 11:29144224-29144246 GATTTTGTGGGTCACGAATTTGG - Intergenic
1081089079 11:38839840-38839862 GTTTCTGTGGGTCAGAAATTTGG - Intergenic
1081695518 11:45106521-45106543 GATTCTGTGGGTCAGAAATTTGG + Intronic
1083043432 11:59710583-59710605 GATTCTATGGGTCAACAATCTGG + Intergenic
1084401526 11:68946699-68946721 GGTTCTGTGGCTCAAGAATTTGG + Intergenic
1084435763 11:69138424-69138446 GTTTCTGTGGGTCAGGAATTTGG + Intergenic
1084487858 11:69461515-69461537 GATTCTGTGGCTCAAGAAATGGG - Intergenic
1084875879 11:72133008-72133030 GATGTTGTGAGTCAGGAATTTGG + Intronic
1085080219 11:73627755-73627777 GATTCTGTGGGTCAGTAATTTGG + Intergenic
1085198885 11:74689469-74689491 AATTCTGTGGGTCAGCAACTTGG + Intergenic
1086446318 11:86874726-86874748 GGTTCTGTGGGTCATGAATTGGG + Intronic
1086479129 11:87215349-87215371 GATTCTGTGAGTCAGTAATTTGG + Intronic
1087308207 11:96508224-96508246 GCTGCTGTGTCTCTACAATTAGG + Intergenic
1087341080 11:96907990-96908012 GTTTCTGTGGGTCAGGAATTTGG + Intergenic
1088934460 11:114385000-114385022 GTTTCTGTGGGTCAGAAATTTGG - Intergenic
1089594471 11:119568436-119568458 GCTGTTTTGGGTCAACAATGAGG - Intergenic
1090417893 11:126553353-126553375 GGTGCTGCGGGTCTACAAATGGG - Intronic
1090853016 11:130587153-130587175 GTTTCTGTGGGTCAGGAATTTGG + Intergenic
1091882823 12:3993249-3993271 GATTCTCTGGGTCAGGAATTCGG - Intergenic
1091888625 12:4034699-4034721 GATGCTGTGGATCAATAGTTGGG + Intergenic
1092774106 12:11927398-11927420 GATTCTGTGGGTCAGGAATTTGG + Intergenic
1093688200 12:22080306-22080328 AATTCTGTGGATCAACAATTTGG + Intronic
1094642209 12:32287488-32287510 GATTCTGTTGGTCAGCAATTTGG + Intronic
1095114726 12:38339620-38339642 AATTCTGTTGGTCAGCAATTTGG + Intergenic
1095160717 12:38912010-38912032 GATTCTTTGGGTCAGAAATTAGG + Intergenic
1095425678 12:42072363-42072385 GATTTTGTGGGTCAGGAATTTGG + Intergenic
1095647852 12:44570279-44570301 GATGCTGGTGCTCCACAATTAGG + Intronic
1095913263 12:47450042-47450064 GTTTCTGTGGGTCAGAAATTAGG - Intergenic
1097615361 12:61879045-61879067 CATGCTGTGGCTCAACGCTTTGG + Intronic
1097725123 12:63066454-63066476 AATTCTGTGAGTCAAAAATTAGG - Intergenic
1098007867 12:66018509-66018531 TATGATATGGGCCAACAATTCGG - Intergenic
1098724291 12:73943072-73943094 CTTGCTTTGGGTAAACAATTTGG + Intergenic
1098903381 12:76135747-76135769 GATTCTGTGAGTCAGGAATTTGG - Intergenic
1099418860 12:82427353-82427375 GTTTCTGTGGGTCAAGAATTTGG + Intronic
1100158940 12:91834900-91834922 TATTCTGTGGGACAAAAATTTGG - Intergenic
1100626239 12:96335808-96335830 GAAATTGTGGGTCAAGAATTTGG - Intronic
1101173393 12:102122982-102123004 GATTCTGTGGATCAGCAGTTTGG + Intronic
1101257277 12:102990789-102990811 GATTGCGTGGGTCAGCAATTTGG - Intergenic
1102727364 12:115077502-115077524 CATTCTGTGGGTCAGGAATTTGG - Intergenic
1102763319 12:115408568-115408590 TATTCTGTGAGTCAAAAATTTGG + Intergenic
1103208796 12:119151610-119151632 GATCCTGTGGATCAGCAATTGGG + Intronic
1104524966 12:129512563-129512585 GTTTCTGAGGGTCAAGAATTTGG + Intronic
1105346020 13:19573434-19573456 GATTCTGTGGGTTAGCAATTTGG - Intergenic
1106030049 13:25991953-25991975 GATTCTGTGGGTTGACAGTTTGG + Intronic
1106209785 13:27631141-27631163 GTTTCTGTGGGTCAAGAATCTGG + Intronic
1106283399 13:28297460-28297482 GATTCTGTGGGTCAGGAATCTGG + Intergenic
1106801879 13:33264258-33264280 GATTCTGTGGGTCAGGAGTTTGG - Intronic
1108190521 13:47933890-47933912 GATACTTTGGGTTAACAGTTAGG - Intergenic
1108326723 13:49340068-49340090 GTGGCTATGGGTCCACAATTTGG + Intronic
1108516230 13:51205468-51205490 GATTTTGTGGGTCAGGAATTTGG - Intergenic
1108621381 13:52187726-52187748 GATTCTGTGGGTTAGCAATTTGG - Intergenic
1108665259 13:52623819-52623841 GATTCTGTGGGTTAGCAGTTTGG + Intergenic
1108726087 13:53183079-53183101 GATTCTGTGGGTCAGCAGTTTGG - Intergenic
1109207394 13:59497579-59497601 TATTCTGTGGGTCCACAGTTGGG - Intergenic
1109356701 13:61239212-61239234 GTTTCTGTGGGTCAGAAATTCGG + Intergenic
1109739899 13:66539597-66539619 GATTCTGTGGGTCAGTAACTTGG - Intronic
1110238651 13:73242820-73242842 GATTCTGTGGTTCAGGAATTTGG - Intergenic
1111099009 13:83556040-83556062 GTTCCTATGGGTCAAGAATTTGG + Intergenic
1112217363 13:97446889-97446911 GATGCTGTGGGTCAACAATTTGG - Intronic
1112266722 13:97931314-97931336 GATTCTGTAGGTCAGCAATCTGG + Intergenic
1113629311 13:111870713-111870735 GATTCTGAGGGTAAAAAATTGGG - Intergenic
1114710822 14:24776318-24776340 GATTCTATGGGTTAACAATTTGG - Intergenic
1115327245 14:32153807-32153829 GATGCGGTGGCTCAACACTTTGG + Intronic
1116187682 14:41618623-41618645 GATTTTATGGGTCAGCAATTTGG - Intronic
1116503879 14:45653990-45654012 GATACCGTGGGTCAGCAATCTGG + Intergenic
1116864491 14:50020337-50020359 GATTCTGTGGGGCAGCCATTTGG + Intergenic
1117049853 14:51849033-51849055 GTTTCTGTGGGTCAGGAATTTGG + Intronic
1117161822 14:52996962-52996984 GATTCTGTGGATCAGAAATTTGG - Intergenic
1117236247 14:53780172-53780194 GATGCTGTCAGTCAGAAATTTGG + Intergenic
1117476253 14:56098091-56098113 GATTCTGTGGGTCAGGAATTTGG + Intergenic
1117717970 14:58600111-58600133 GATTCTGTGGGTCAGGAATTTGG - Intergenic
1118661059 14:68013023-68013045 GATTCTGTGGGTCAGGAATTCGG + Intronic
1119570362 14:75665453-75665475 GATGAGGTTGGACAACAATTGGG - Intronic
1119632270 14:76243382-76243404 ATTTCTGTGGGTCAAGAATTTGG - Intronic
1119992581 14:79215998-79216020 GATTCTGTGGGCCAGAAATTTGG + Intronic
1120739009 14:88087050-88087072 GGTTCTGTGGGTCAAGAGTTTGG - Intergenic
1121420107 14:93807185-93807207 GATTCTGTGGGTCAGGAATCAGG - Intergenic
1121459544 14:94064239-94064261 GAAGCTCTGTGTCAAGAATTAGG - Intronic
1122013817 14:98776186-98776208 GAGTCTGTGAGTCAAGAATTTGG + Intergenic
1122704993 14:103615259-103615281 GATTCTGTGGGTCAAAGATTTGG + Intronic
1122964857 14:105118209-105118231 GGTTCTGTGGGTTGACAATTTGG - Intergenic
1124472172 15:29997698-29997720 AATTCTGTGGGTCAGGAATTTGG + Intergenic
1124611362 15:31211570-31211592 AATTCTGTGGGTCAACAATTTGG - Intergenic
1124627253 15:31315387-31315409 GCTTCTGTGGGTCAAGAATTTGG + Intergenic
1126343293 15:47667150-47667172 GATTCTGTAGGTCAGGAATTTGG - Intronic
1127107793 15:55635487-55635509 AATTCTTTGAGTCAACAATTTGG - Intronic
1127845463 15:62866570-62866592 GCTGCTGTGGGTCAGCAATCAGG + Intergenic
1129688768 15:77701406-77701428 GATGCTTTGGGGCAGGAATTTGG - Intronic
1130401256 15:83556757-83556779 GATTCTGTGGGTCAGCAATTTGG + Intronic
1130992201 15:88882240-88882262 GATTCTGTGGGTCAGCATTTTGG - Intronic
1131105886 15:89734240-89734262 GAGTCTGTAGGTCAGCAATTTGG + Intronic
1131670679 15:94616492-94616514 GATTTTGTGGGTCAGAAATTTGG + Intergenic
1133006483 16:2884313-2884335 GATTCTGTGGGTCCACCATGAGG + Intronic
1133487070 16:6230560-6230582 AATTCCGTGGGTCAACAGTTTGG + Intronic
1134517625 16:14899794-14899816 GATCCCGTGGGTCAAGAATTTGG - Intronic
1134557858 16:15181616-15181638 AATTCTGTGAGTCAACAATTTGG - Intergenic
1134705293 16:16298445-16298467 GATCCCGTGGGTCAAGAATTTGG - Intergenic
1134918395 16:18093219-18093241 AATTCTGTGAGTCAACAATTTGG - Intergenic
1134962248 16:18413669-18413691 GATCCCGTGGGTCAAGAATTTGG + Intergenic
1134966545 16:18496268-18496290 GATCCCGTGGGTCAAGAATTTGG + Intronic
1135593256 16:23720693-23720715 GGTTCTGTGGGTCAAGAATGTGG + Intergenic
1135609544 16:23854390-23854412 GTTTCTGTGGGTCAGTAATTTGG + Intronic
1136384732 16:29916740-29916762 GTTTCTGTGGGTCAGGAATTTGG + Intronic
1137516194 16:49146737-49146759 GATTCTATGGGTCAGCAATTTGG + Intergenic
1137602937 16:49768880-49768902 GATGGTGTGGCTCAAAAGTTCGG - Intronic
1137805298 16:51299023-51299045 GATTCTGTGGGTCAGCAATTTGG - Intergenic
1137873850 16:51976531-51976553 GATACTGTGGGTCAGAAATTTGG - Intergenic
1138077462 16:54056792-54056814 GTTTCTGTGGGTCAGGAATTTGG - Intronic
1140066283 16:71614242-71614264 GATTCTGTGGGTCGGGAATTTGG + Intergenic
1140117031 16:72050937-72050959 GATTCTGTGGGTCAGCAATGTGG + Intronic
1141189405 16:81813603-81813625 AATTCTGTGGGTCAGGAATTTGG + Intronic
1141822043 16:86453121-86453143 GATTCTGTGGGTCAAGAATTTGG - Intergenic
1143261882 17:5605620-5605642 GATTTTGTAGGTGAACAATTTGG + Intronic
1143463298 17:7117802-7117824 GATTCTCTGGGTCAGAAATTTGG - Intergenic
1143740082 17:8946081-8946103 GATTCTGTGGGCCAGGAATTTGG - Intronic
1143908907 17:10231322-10231344 GTTTCTGTGGGTCAGGAATTTGG - Intergenic
1143934875 17:10473282-10473304 CATTCTGTGGGTCAATAATTTGG + Intergenic
1144235418 17:13256137-13256159 GGTGCTGTGGGTCAAAAACTTGG + Intergenic
1146542844 17:33712483-33712505 GTTTCTGTGGGTAAAGAATTCGG + Intronic
1146604143 17:34243857-34243879 GGTGCTGTGGGCCAACATTTAGG + Intergenic
1149431808 17:56600218-56600240 GATTCTGTGAGTGAGCAATTTGG + Intergenic
1149852994 17:60052316-60052338 GTTTCTGTGGGTCAGGAATTAGG - Intronic
1150999391 17:70357057-70357079 GATGCTGTGAGATAATAATTGGG - Intergenic
1151741675 17:75987156-75987178 GTTACTGTGGGTCAGGAATTTGG + Intronic
1151764810 17:76127329-76127351 GAGGCAGTTGGTCAACTATTGGG - Intergenic
1152636692 17:81433086-81433108 GCAGCTGTGGGTCACCACTTGGG + Intronic
1152845650 17:82598122-82598144 GATGATGGGAGTCAACAATACGG - Intronic
1158347956 18:56534717-56534739 GATTCTGTGGGTCAGCAATTTGG - Intergenic
1158840982 18:61387045-61387067 TATCCTGTGGGTGAATAATTTGG + Intronic
1159247970 18:65834956-65834978 GATTTTGTGGGTCAGTAATTTGG + Intronic
1160044363 18:75373017-75373039 GATTCTATGGGTCAGCAATGTGG + Intergenic
1160888407 19:1363427-1363449 GGTGCTGTGGGGCACCCATTGGG + Intronic
1161228518 19:3160092-3160114 GATTTTGTGGGTCAGGAATTTGG + Intronic
1162011551 19:7819072-7819094 GATTGTGTGGTTCACCAATTTGG + Intergenic
1163049336 19:14670100-14670122 GTTTCTGTGGGTCAAGAATCTGG + Intronic
1164419015 19:28071319-28071341 CATGTTGAGGGTCAGCAATTTGG - Intergenic
1164600449 19:29559899-29559921 GATTCTGTGGCTCAGCAATTTGG + Intronic
1165099566 19:33430985-33431007 GGTGCTGTGGCTCAGCACTTTGG + Intronic
1165636336 19:37343427-37343449 AATCCTGTGGGTCAGCAAGTAGG + Intronic
926631475 2:15140329-15140351 GACCCTGTGGGTCAGGAATTTGG - Intergenic
927248209 2:20975036-20975058 GATTCTGTGGATCAGCAATTTGG + Intergenic
927829539 2:26337497-26337519 AATTCTGTGGGTCAGCAATTTGG - Intronic
929733681 2:44523197-44523219 GATTCTGTAGGTCAAGAATTTGG + Intronic
930047990 2:47190566-47190588 GATGCTGTGGGTCACTGATGGGG - Intergenic
930163275 2:48179235-48179257 GATTCTGTGAGTCAAGGATTTGG - Intergenic
931086515 2:58837054-58837076 TATTTTGTGGGTCAACTATTTGG - Intergenic
931387436 2:61810086-61810108 GATTCTGTGGGTCAACAATTTGG - Intergenic
932089972 2:68797686-68797708 GCTGCTGTGGGACAACATTCTGG - Intronic
932504220 2:72213300-72213322 TATTCTGTGGGTCAGGAATTTGG - Intronic
932826411 2:74945169-74945191 GTTTCTGTGGGTCAGGAATTTGG + Intergenic
932958991 2:76390035-76390057 GATGCTGTGGGTTAGAAAATTGG + Intergenic
933881708 2:86676144-86676166 AATTCTGTGGGTCAGCAATTTGG - Intronic
934704144 2:96464593-96464615 GCTTCTGTGAGTCAAGAATTTGG + Intergenic
935493182 2:103746047-103746069 GAAGCTCTGTGTCAACAACTAGG - Intergenic
935647319 2:105350153-105350175 GATTCTGAGAGTCATCAATTTGG - Intergenic
935886486 2:107624980-107625002 GATGCTGTGGAAAAACCATTAGG + Intergenic
936087435 2:109478894-109478916 GATGCTGTGGGTTGGGAATTGGG + Intronic
936264001 2:110986387-110986409 GATTCTGTAGGTCAGCAGTTTGG + Intronic
937533093 2:122853828-122853850 TATGGTGTAGGTCAACAAGTAGG + Intergenic
939467386 2:142576604-142576626 AATTCTGTAGGTCAAAAATTAGG + Intergenic
939592587 2:144083458-144083480 AATTCTGTGAGTCAAGAATTTGG - Intronic
940021920 2:149164957-149164979 GATTCTGTGGGTCAGCAATTTGG + Intronic
940100445 2:150031733-150031755 GTTGCTGTGGTTTAACAATGGGG + Intergenic
940188916 2:151017898-151017920 GTTTCTCTGGGTCAAGAATTTGG + Intronic
941023582 2:160436490-160436512 GATTCTGTGGCTCAGGAATTTGG - Intronic
941669166 2:168272582-168272604 GATTCTGTGGGTCAGTAATGTGG - Intergenic
941718146 2:168785538-168785560 GGCTCTGTGGGTAAACAATTTGG - Intergenic
941740409 2:169029474-169029496 GATGCTGTGTGTCAACACTGTGG + Intronic
941903726 2:170701675-170701697 GATTTTCTGGGTCAAGAATTTGG + Intergenic
942181412 2:173384431-173384453 GATTCTATGGGTCAGGAATTTGG - Intergenic
942790869 2:179758872-179758894 GATTCTGTGGGTCAGAAATGTGG - Intronic
942821079 2:180115880-180115902 GAGTCTGTGGGTGAGCAATTTGG - Intergenic
943144594 2:184025876-184025898 AATGTTGTGGGTCAAGAAATAGG - Intergenic
943791138 2:191933750-191933772 GTTTCTGTGGGTCAAGAATCTGG + Intergenic
945260971 2:207843234-207843256 GGTGCGGTGGCTCAACACTTTGG - Intronic
945794799 2:214348790-214348812 GATATTGTTGGTCAGCAATTTGG - Intronic
946452372 2:219791781-219791803 GTTTCTGTGGGTCAGGAATTTGG - Intergenic
947369980 2:229435392-229435414 GATTCTGTGGGTTGATAATTTGG - Intronic
947423386 2:229960745-229960767 GGTGTTGTGGCTCAACACTTTGG - Intronic
947789929 2:232859583-232859605 CATTCTGTGGGTCAGGAATTTGG + Intronic
948166852 2:235869640-235869662 GATTCTGTGGGTCAGGAGTTTGG + Intronic
948834265 2:240617329-240617351 GTTCCTGTGGGTCAGGAATTCGG - Intronic
1168983702 20:2029350-2029372 CATTCTGTGAGTCAAGAATTTGG + Intergenic
1169002939 20:2181223-2181245 GATTCTGTGGGTCAGAAATTTGG - Intergenic
1169030745 20:2405014-2405036 AATTCTGTGGGTCAACAATTTGG + Intronic
1169092227 20:2867936-2867958 CATTATGTGGGTCAAGAATTTGG + Intronic
1169226917 20:3862657-3862679 GATCCTGTGGGTCAGGCATTTGG + Intronic
1169470007 20:5877079-5877101 AATGTTGAGGGTCAACAAGTTGG + Intergenic
1169551747 20:6708210-6708232 GATCCTCTGGGTCAGGAATTTGG - Intergenic
1169583169 20:7048268-7048290 ATTTCTGTGGGTCAACAATTTGG - Intergenic
1169669660 20:8082293-8082315 GATTCTTTGGGTCAGGAATTTGG - Intergenic
1169848737 20:10026423-10026445 ATTTCTGTGGGTCAAGAATTTGG + Intronic
1169951090 20:11043902-11043924 GGTTCTGTTGGTCAGCAATTTGG - Intergenic
1170028701 20:11920781-11920803 TATTCAGTGGGTCAACAAGTTGG + Intronic
1170210843 20:13844998-13845020 GATTTTGTGGGTCAGGAATTTGG - Intergenic
1170419305 20:16176643-16176665 GATTCTGAGGGGCAAGAATTTGG - Intergenic
1170546264 20:17437757-17437779 GATGCTCTGGGTCAGGAATTTGG + Intronic
1170623649 20:18014196-18014218 GATTCTGTGGGTCAAAGATTTGG - Intronic
1170697736 20:18674982-18675004 GTTTCTGTGGGTCAGGAATTTGG + Intronic
1170757428 20:19216820-19216842 GATACTTTGGGTCAGGAATTTGG + Intronic
1170806315 20:19635541-19635563 GATTCTGTGGGCCAAGAATTTGG + Intronic
1170880453 20:20292495-20292517 GATCCTGTGAGTCAGGAATTTGG + Intronic
1171394096 20:24819871-24819893 GATTCTGTGGGTAAGGAATTTGG - Intergenic
1172615358 20:36279830-36279852 GACTCTGTGGGTCAAGAATTTGG + Intergenic
1172688864 20:36777037-36777059 GATGCTATGGGTCAGGAATTTGG - Intergenic
1173159749 20:40643706-40643728 GTAGCTGTGGGGCAAAAATTCGG - Intergenic
1173640420 20:44597987-44598009 GTTTCTGTGGGTCAGGAATTTGG + Intronic
1173817613 20:45999838-45999860 TATTCTGTGGGTCAGAAATTTGG - Intergenic
1174216010 20:48916894-48916916 GTTTCTGTGGGTCAGGAATTTGG - Intergenic
1174796303 20:53525316-53525338 GATTTTGTGGGTCAGGAATTTGG - Intergenic
1175132473 20:56799814-56799836 GATTCTGAGGGTCAGCATTTTGG - Intergenic
1175619137 20:60428696-60428718 ATTACTGTGGGTCAAAAATTTGG + Intergenic
1175623389 20:60469699-60469721 AATGTTGTGGGTCAGAAATTTGG + Intergenic
1177500476 21:21948290-21948312 GGTACTGTGGGTCAGCAGTTAGG - Intergenic
1179147709 21:38783109-38783131 GATATTGTGGGTCATGAATTGGG + Intergenic
1179823216 21:43949276-43949298 AATTCTGTGGGTCAGCAATTTGG + Intronic
1181183375 22:21082944-21082966 AATGCTTTGGGAAAACAATTTGG + Intergenic
1181764938 22:25084650-25084672 GATCCTGTGGGTCAGAAATTAGG + Intronic
1182534973 22:30994204-30994226 GATTCTGTGGGTCAGGAATTGGG + Intergenic
1183001015 22:34859171-34859193 AATTTTGTGGGTCAATAATTAGG + Intergenic
1183224413 22:36539634-36539656 GTTTCTGTGGGTCAGGAATTGGG + Intergenic
1183493772 22:38130199-38130221 GAAGCTGTGGGTCTAGAATGGGG + Intronic
1183669142 22:39262094-39262116 GTTTCTGTGGGTCAGGAATTTGG - Intergenic
1183761049 22:39818369-39818391 GATTCTCTGGGTCAGGAATTAGG - Intronic
1184882863 22:47322457-47322479 GTTTCTGTGGGTCAGGAATTTGG + Intergenic
949522929 3:4873079-4873101 GATTCTCTGGGTCAGGAATTGGG - Intronic
949930709 3:9076185-9076207 GATTCTGTGGGTCAGCAATTTGG - Intronic
951655660 3:25005312-25005334 TTTTCTGTGGGTCAAGAATTTGG + Intergenic
952516416 3:34108925-34108947 GATTCTGTGGGGCATAAATTTGG + Intergenic
952935425 3:38394688-38394710 GTTTCTTTGGGTCAAGAATTTGG + Intronic
953205846 3:40828341-40828363 AATTCTGTGGGTCAGCAGTTTGG + Intergenic
953238305 3:41125551-41125573 GATGTTGTGAGTCAGCAATTTGG - Intergenic
953708981 3:45253506-45253528 GATTCTGTGGGTCATGAATTTGG - Intergenic
953758772 3:45670402-45670424 CATGCTGTGGGTCAGGATTTAGG + Intronic
953808244 3:46090139-46090161 GTTTCTGTGGGTCAGGAATTTGG + Intergenic
954337051 3:49924986-49925008 GTTCTTGTGGGTCAAGAATTTGG - Intronic
954766335 3:52920350-52920372 GTTTCTGTGGGTCAGGAATTTGG - Intronic
954916991 3:54156867-54156889 GTTTCTGTGGGTCAGGAATTGGG - Intronic
955056429 3:55459672-55459694 GATTCTGTGGGTCAGCAGTCTGG - Intergenic
955872880 3:63458317-63458339 GATTCTGTGGGTCAGCAATTTGG + Intronic
956216350 3:66853386-66853408 AATTCTGTGGGTCAGAAATTTGG + Intergenic
957014197 3:75044033-75044055 TCTGCAGTGGCTCAACAATTTGG - Intergenic
957015027 3:75053300-75053322 GATGCTGTGGGTTGTCCATTTGG - Intergenic
957367942 3:79251413-79251435 AATACTGTAGGTCAACAAATTGG + Intronic
957489015 3:80899106-80899128 GATCCTGGGGGTCAACATATGGG - Intergenic
961025092 3:123548475-123548497 GTTTCTGTGGGTCAGGAATTCGG - Intronic
961744046 3:129052281-129052303 GTTTCTGTGGGTCAAGAACTTGG - Intergenic
962918442 3:139929916-139929938 GATTCTATGGGTCAGGAATTTGG + Intergenic
967044607 3:185725173-185725195 GATTCTGTGGGTCAGGAATTTGG - Intronic
967895517 3:194392912-194392934 GTTTCTGAGGGTCAAGAATTTGG - Intergenic
969084702 4:4647305-4647327 GATTCTCTGGGTCAGGAATTTGG - Intergenic
969327974 4:6454633-6454655 GATTCTGTGAGTCAGGAATTTGG - Intronic
970805663 4:20028165-20028187 AATTGTGTGGGTCAGCAATTTGG + Intergenic
970891441 4:21049315-21049337 TATTCTGTGGGTCAAGGATTTGG - Intronic
971387870 4:26158008-26158030 GATTCTCTGGGTCAGCAATTTGG - Intergenic
971681089 4:29701602-29701624 GGTTCTGTGGGTCAGAAATTTGG + Intergenic
971755617 4:30704326-30704348 TATTATGTGGGTCAAGAATTTGG + Intergenic
971784806 4:31086298-31086320 AATGCTGTAGGTCAAGAATTAGG - Intronic
974093893 4:57340699-57340721 AATTCTGTGGGTCAGGAATTTGG + Intergenic
974344390 4:60660430-60660452 GATGCTGTGGTTGAATATTTTGG - Intergenic
974850422 4:67398075-67398097 AATTCTGCAGGTCAACAATTTGG + Intergenic
975731805 4:77344740-77344762 GACCCTGTGGTTAAACAATTAGG + Intronic
976060691 4:81124771-81124793 GTTTCTGTGGGTCAGGAATTTGG - Intronic
976945987 4:90768379-90768401 GTTTCTGTGGGTCAGAAATTAGG - Intronic
977020712 4:91755644-91755666 GAAGCTTTGGGTAAATAATTAGG + Intergenic
978166835 4:105619430-105619452 AATTGTATGGGTCAACAATTGGG - Intronic
978738086 4:112107042-112107064 GATTCTGTGGATCAGGAATTTGG - Intergenic
979721855 4:123909643-123909665 GATTCTGTGGCTCAGGAATTTGG + Intergenic
981046486 4:140269607-140269629 GATTTTGTGGGTCAGGAATTTGG - Intronic
981124082 4:141085635-141085657 GATTCTGTGGGTCAGGAATTTGG - Intronic
982464923 4:155718450-155718472 GATTCTGTGCATCAAAAATTTGG + Intronic
982854958 4:160370145-160370167 AATTCTGTGAGTCAACAATTTGG + Intergenic
983281940 4:165692091-165692113 GCTGCTGTAGGTTAACAAATTGG - Intergenic
983314642 4:166115496-166115518 GATGCTGTGGGTTAGAAATAAGG + Intergenic
983414007 4:167432803-167432825 GATTTTGTGGGTCAGGAATTTGG - Intergenic
983427079 4:167598551-167598573 GATTTTGTGGGTCAAGACTTAGG - Intergenic
983643785 4:169969383-169969405 GATTCTGTGGGACAGGAATTTGG - Intergenic
983844023 4:172494317-172494339 GATGCTGTGAATCAAAAACTTGG - Intronic
984248913 4:177308421-177308443 GTTTCTGTGGGTCAGGAATTTGG - Intergenic
984875353 4:184363062-184363084 GATTCTGTAGGTCAGGAATTTGG + Intergenic
986349273 5:6862301-6862323 GATTCTGTGGGCCAGGAATTTGG + Intergenic
987236903 5:15951803-15951825 GTTTCTGTGGGTCAGGAATTAGG + Intergenic
988339519 5:29951841-29951863 GTTCCTGTGGGTCAAGAATATGG - Intergenic
988549937 5:32191219-32191241 TAGGCTGTGGTTCAGCAATTTGG + Intergenic
989149866 5:38288793-38288815 GAAGCAGTTGCTCAACAATTTGG - Intronic
990710203 5:58572318-58572340 GATTCTGTGGGTTGAAAATTGGG - Intergenic
990717847 5:58658629-58658651 TATTCTGTGGGTCAGCAATTTGG + Intronic
990994212 5:61715065-61715087 GATTCTGTGGGTCAGGAATCTGG - Intronic
990998480 5:61757789-61757811 GTTTCTGTGGGTCAGGAATTTGG + Intergenic
992623748 5:78618345-78618367 CATTTTGTGGGTCAAGAATTTGG + Intronic
993824899 5:92671488-92671510 TGTTCTGTGGGTCGACAATTTGG + Intergenic
993843097 5:92905583-92905605 ATTTCTGTGGGTCAAAAATTTGG + Intergenic
993983616 5:94570848-94570870 GATGGGGTGGGTCAATACTTGGG - Intronic
994781676 5:104096950-104096972 GTTTCTGTGGGTCAGGAATTTGG + Intergenic
995114471 5:108463963-108463985 GATTCTGTGAGTCAGCAATATGG + Intergenic
995574142 5:113512198-113512220 TGTTCTGTGGGTCAACAGTTTGG + Intergenic
996623892 5:125545339-125545361 AATGCTGTGGTGCAATAATTTGG + Intergenic
996697530 5:126415164-126415186 GATGCAGGGGGTGGACAATTGGG + Intronic
998013992 5:138717843-138717865 GATTCTATGGGTCAGTAATTTGG + Intronic
998725177 5:145004433-145004455 GATGCTATGAGTTAAGAATTTGG + Intergenic
999218464 5:149955628-149955650 GTTTCTGTGGGTCAGGAATTTGG - Intergenic
999699077 5:154211609-154211631 GTTTCTGTGGGTCAGAAATTTGG + Intronic
1000130543 5:158293410-158293432 GATTCTGTGGTTCAGCAATTTGG + Intergenic
1002284603 5:178153955-178153977 GAAGCTGGGCGTCAACGATTGGG - Exonic
1003414166 6:5893347-5893369 AATTCTGTGGGTCAGGAATTTGG + Intergenic
1004875083 6:19943129-19943151 GTTTCTGTGGGTTAGCAATTTGG - Intergenic
1005799022 6:29400299-29400321 GATTCTGTGGGTCAGAAATTGGG + Intronic
1005818919 6:29580762-29580784 CATGTTGTGGGCCAAGAATTTGG - Intronic
1005971803 6:30767644-30767666 GATTCTGTGGGCCAGGAATTTGG + Intergenic
1006135793 6:31896129-31896151 GCTGCTGTGTGTCAAATATTAGG - Intronic
1006649019 6:35535719-35535741 GATTCTGTGGGTCAGCTGTTTGG + Intergenic
1009608309 6:65903334-65903356 GGTGCAGTGGGTCAGTAATTTGG - Intergenic
1012979972 6:105819036-105819058 GCTGCTATGGGACAACACTTGGG - Intergenic
1014148111 6:118021736-118021758 GATTTTGTGGGTCAGCAATTTGG + Intronic
1014951816 6:127564886-127564908 CAGTCTGTGGGTCAGCAATTTGG + Intronic
1015245951 6:131074819-131074841 GGTTCTGTGGGTCAGGAATTCGG - Intergenic
1015783962 6:136901349-136901371 AATTCTGTGAGTCAGCAATTTGG + Intronic
1016999308 6:149984844-149984866 GACGCTGGGGGACAACAATCAGG + Intergenic
1018462754 6:164014671-164014693 GATGATGTGGGTCCAAGATTCGG - Intergenic
1020902340 7:14020708-14020730 GTTCCTGTGGGTCAAGAATTTGG + Intergenic
1022437830 7:30407131-30407153 GATTCTGTGAGTCAGAAATTTGG + Intronic
1022903487 7:34833651-34833673 GTTTCTGTGGGTCAAGAATTTGG + Intronic
1024028711 7:45437075-45437097 GTTTCTGGGGGTCAAGAATTTGG + Intergenic
1026215061 7:68341264-68341286 AACGCAGTGGGTCAAAAATTTGG - Intergenic
1027973413 7:85117328-85117350 GTTTCTCTGGGTCAAGAATTTGG - Intronic
1028422353 7:90648099-90648121 GTTTCTGTGGGTTAGCAATTTGG + Intronic
1029711982 7:102304675-102304697 GATGCTGTGGTTCCCCAGTTTGG - Intronic
1030029101 7:105352516-105352538 GTTTCTGTGGGTTAAGAATTTGG - Intronic
1031178344 7:118381119-118381141 GATTCTGTGGGTCAAGAGTCTGG - Intergenic
1031536219 7:122936493-122936515 AATTCTGTGGGTCAGCAATTTGG + Intergenic
1033156674 7:138962733-138962755 GATTCTGCGGGTCAGGAATTCGG - Intronic
1033553971 7:142471898-142471920 GCTGCTGTTGGCCAACATTTGGG + Intergenic
1034504174 7:151472859-151472881 CTCGCTGTGGGTCAACAAATGGG + Intronic
1034526634 7:151667879-151667901 AATTCTGTGGGTCAGCAATTTGG - Intronic
1038403094 8:27300312-27300334 GTTTCTGTGGGTCAGGAATTGGG - Intronic
1038857674 8:31351025-31351047 CATTCTGTGGGTCAGTAATTTGG + Intergenic
1039285734 8:36038765-36038787 GTTTCTGTGGGTCATAAATTTGG - Intergenic
1039852557 8:41382662-41382684 GTTTCTGTGGGTCAAAAATCTGG + Intergenic
1040968947 8:53113308-53113330 GAAGCTGTGTGTCAACAACAGGG - Intergenic
1041499039 8:58519480-58519502 GATTTTGTGGGTCAAGAATATGG - Intergenic
1041653282 8:60322450-60322472 GTTTCTGTGGGTCAAGAGTTTGG + Intergenic
1042027089 8:64435576-64435598 GATTCTGTAGGTCAGGAATTAGG + Intergenic
1042857261 8:73280020-73280042 GATTCTGTGGGTCAGGAATTCGG - Intergenic
1043302085 8:78746216-78746238 GTTTCTGTGGATCAAGAATTTGG + Intronic
1043545935 8:81315823-81315845 AATTCAGTGGGTCAGCAATTTGG + Intergenic
1044502789 8:92979017-92979039 AAATCTGTGGGTCAAGAATTTGG + Intronic
1044624492 8:94223406-94223428 GAGGGTCTGGGTCAATAATTGGG + Intergenic
1045308706 8:100981930-100981952 GTTTCTGTGGGTCAGGAATTCGG + Intergenic
1045484094 8:102617166-102617188 GTTTCTGTGGGTCAGGAATTTGG + Intergenic
1045585801 8:103535630-103535652 CAAACTGTGGGGCAACAATTTGG + Intronic
1047661125 8:127038062-127038084 GTTTCTGAGGGTCAAGAATTTGG - Intergenic
1048178464 8:132173634-132173656 GATGATGTGGGTAAAGCATTTGG + Intronic
1048724685 8:137369677-137369699 GATGCTGTGGGTCGACACCATGG + Intergenic
1048943009 8:139418800-139418822 GATTCTGTGGGTCAGCAGTTTGG - Intergenic
1049452995 8:142672411-142672433 GATTCTGTGGGGCAGGAATTTGG + Intronic
1050007091 9:1143247-1143269 GATACTGTGGGTCAGCATCTGGG + Intergenic
1051013787 9:12450712-12450734 GTCTCTGTGGGTCAAGAATTTGG + Intergenic
1051140107 9:13969628-13969650 GTTTCTGTGGGCCAAGAATTTGG + Intergenic
1052067828 9:24044621-24044643 GTTTCTGTGGTTCAAGAATTTGG + Intergenic
1053510818 9:38686630-38686652 GATGCTCTGGGGCATCAAGTAGG + Intergenic
1055457763 9:76488966-76488988 CATTCTGTTGGTCAAGAATTCGG + Intronic
1056226429 9:84500151-84500173 GAGTCTGTGGGTCAGGAATTAGG + Intergenic
1056809164 9:89750905-89750927 GGTCCTGTGGGTCAGGAATTTGG + Intergenic
1056937929 9:90931926-90931948 CCTGCTGTGGGGCAAGAATTGGG - Intergenic
1057105006 9:92406564-92406586 GTTTCTGTGGGTCAGGAATTTGG + Intronic
1058463416 9:105204674-105204696 GTTTCTGTAGGTCAAGAATTTGG - Intergenic
1059255909 9:112930466-112930488 GCTTCTGTGGGTCAGAAATTTGG + Intergenic
1059410412 9:114128431-114128453 GATTCTATGGGTCAGGAATTTGG - Intergenic
1062366826 9:136213937-136213959 CATGCTGTGGATCAGCAGTTTGG - Intronic
1062683830 9:137799717-137799739 GAAGCTGGGCGTCAACAACTGGG - Intronic
1185776788 X:2809635-2809657 GATTATGTGAGTCAGCAATTTGG + Intronic
1186416583 X:9388685-9388707 AATTCCGTGGGTCAGCAATTTGG - Intergenic
1186950366 X:14617767-14617789 GATTCTTTGGTTCAACTATTTGG - Intronic
1187210676 X:17228435-17228457 GATTCTGCGGGTCAGAAATTTGG - Intergenic
1187377848 X:18772686-18772708 GTTTCTGTGGGTCAGAAATTTGG + Intronic
1187744881 X:22398493-22398515 GATTCTATGGGTCAGGAATTGGG + Intergenic
1188297674 X:28469830-28469852 AATTCTGTGGGTCAATAATTTGG + Intergenic
1188506927 X:30892985-30893007 TATGCTGTGGGTCAGCAAATTGG + Intronic
1188522861 X:31058079-31058101 GATTTTGTGGGTCAATAATTTGG - Intergenic
1188598680 X:31933209-31933231 TATTCTGTGGGTCAAGGATTTGG + Intronic
1189138445 X:38575288-38575310 GTTTCTGTGGGTCAAAAATCTGG - Intronic
1189241441 X:39527584-39527606 GATTCTGTGGATCAAAAATTTGG - Intergenic
1189257104 X:39648874-39648896 GATGCCGTGGGTCAGAAATCTGG - Intergenic
1189295291 X:39913514-39913536 GATGATGGGGGTCAGGAATTAGG + Intergenic
1189300799 X:39950999-39951021 GATTCTGTGGGTCAGGAATCTGG + Intergenic
1189334752 X:40164271-40164293 GAATCTGTGGGTCCAGAATTTGG - Intronic
1189373449 X:40447857-40447879 GATTCTGTGGGTCAGGAATCTGG - Intergenic
1189889352 X:45582862-45582884 AATTCTGTGGGTTAGCAATTTGG - Intergenic
1189914366 X:45842234-45842256 GATTCTGTGGGTTGGCAATTTGG - Intergenic
1190655119 X:52604996-52605018 GTTGCTGTGTGTCAGGAATTAGG - Intergenic
1190818224 X:53948043-53948065 TATTCTGTGGGTCAGGAATTTGG - Intronic
1191667513 X:63718580-63718602 CATGCTATGGGTCAACAATAGGG + Intronic
1194731180 X:97457505-97457527 GTTTCTGTGGGTCAAGAATTTGG + Intronic
1195496958 X:105547507-105547529 GATTCTGTGGGTCACCAATTTGG + Intronic
1195914319 X:109920971-109920993 AATGCTTTGGGTCAACAGATAGG - Intergenic
1197685849 X:129438752-129438774 AATTCTGTGGGTTAGCAATTTGG - Intergenic
1201293204 Y:12441833-12441855 GATTATGTGAGTCAGCAATTTGG - Intergenic