ID: 1112222055

View in Genome Browser
Species Human (GRCh38)
Location 13:97500943-97500965
Sequence TAGAAGCTAGATCTCTTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112222055_1112222060 -9 Left 1112222055 13:97500943-97500965 CCATTCAAGAGATCTAGCTTCTA No data
Right 1112222060 13:97500957-97500979 TAGCTTCTAGGTGGGTGGATTGG No data
1112222055_1112222061 -8 Left 1112222055 13:97500943-97500965 CCATTCAAGAGATCTAGCTTCTA No data
Right 1112222061 13:97500958-97500980 AGCTTCTAGGTGGGTGGATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112222055 Original CRISPR TAGAAGCTAGATCTCTTGAA TGG (reversed) Intergenic
No off target data available for this crispr