ID: 1112223244

View in Genome Browser
Species Human (GRCh38)
Location 13:97513152-97513174
Sequence TGCCCACTGGATTCCCCCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112223244_1112223253 25 Left 1112223244 13:97513152-97513174 CCACTGGGGGAATCCAGTGGGCA No data
Right 1112223253 13:97513200-97513222 TAGGAGTTTCCCAGTGTGCCTGG No data
1112223244_1112223249 6 Left 1112223244 13:97513152-97513174 CCACTGGGGGAATCCAGTGGGCA No data
Right 1112223249 13:97513181-97513203 AAGTGCCCAGAGGTGTGCCTAGG 0: 8
1: 16
2: 36
3: 76
4: 273
1112223244_1112223254 26 Left 1112223244 13:97513152-97513174 CCACTGGGGGAATCCAGTGGGCA No data
Right 1112223254 13:97513201-97513223 AGGAGTTTCCCAGTGTGCCTGGG No data
1112223244_1112223246 -4 Left 1112223244 13:97513152-97513174 CCACTGGGGGAATCCAGTGGGCA No data
Right 1112223246 13:97513171-97513193 GGCAGCCACCAAGTGCCCAGAGG 0: 2
1: 16
2: 18
3: 57
4: 285

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112223244 Original CRISPR TGCCCACTGGATTCCCCCAG TGG (reversed) Intergenic
No off target data available for this crispr