ID: 1112228364

View in Genome Browser
Species Human (GRCh38)
Location 13:97563618-97563640
Sequence TTCATGCAACCCCATGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112228361_1112228364 4 Left 1112228361 13:97563591-97563613 CCACTTTACAAACATGATCTCTA No data
Right 1112228364 13:97563618-97563640 TTCATGCAACCCCATGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112228364 Original CRISPR TTCATGCAACCCCATGAGGG AGG Intergenic
No off target data available for this crispr