ID: 1112230024

View in Genome Browser
Species Human (GRCh38)
Location 13:97580551-97580573
Sequence TCTATCATACTGGGGGTAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112230011_1112230024 26 Left 1112230011 13:97580502-97580524 CCCAGCACCTTGAATGGTGTCCG No data
Right 1112230024 13:97580551-97580573 TCTATCATACTGGGGGTAGTAGG No data
1112230012_1112230024 25 Left 1112230012 13:97580503-97580525 CCAGCACCTTGAATGGTGTCCGG No data
Right 1112230024 13:97580551-97580573 TCTATCATACTGGGGGTAGTAGG No data
1112230019_1112230024 6 Left 1112230019 13:97580522-97580544 CCGGCACATGTTAGACAGGGGGA No data
Right 1112230024 13:97580551-97580573 TCTATCATACTGGGGGTAGTAGG No data
1112230014_1112230024 19 Left 1112230014 13:97580509-97580531 CCTTGAATGGTGTCCGGCACATG No data
Right 1112230024 13:97580551-97580573 TCTATCATACTGGGGGTAGTAGG No data
1112230010_1112230024 27 Left 1112230010 13:97580501-97580523 CCCCAGCACCTTGAATGGTGTCC No data
Right 1112230024 13:97580551-97580573 TCTATCATACTGGGGGTAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112230024 Original CRISPR TCTATCATACTGGGGGTAGT AGG Intergenic
No off target data available for this crispr