ID: 1112231126

View in Genome Browser
Species Human (GRCh38)
Location 13:97590153-97590175
Sequence GATAGCTCTTGGTTTGTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112231126_1112231131 17 Left 1112231126 13:97590153-97590175 CCAGTAACAAACCAAGAGCTATC No data
Right 1112231131 13:97590193-97590215 TTATCTGCAGAAGATGGCAGGGG 0: 5
1: 1
2: 2
3: 22
4: 257
1112231126_1112231130 16 Left 1112231126 13:97590153-97590175 CCAGTAACAAACCAAGAGCTATC No data
Right 1112231130 13:97590192-97590214 GTTATCTGCAGAAGATGGCAGGG 0: 180
1: 172
2: 120
3: 86
4: 284
1112231126_1112231129 15 Left 1112231126 13:97590153-97590175 CCAGTAACAAACCAAGAGCTATC No data
Right 1112231129 13:97590191-97590213 AGTTATCTGCAGAAGATGGCAGG 0: 185
1: 187
2: 104
3: 111
4: 225
1112231126_1112231128 11 Left 1112231126 13:97590153-97590175 CCAGTAACAAACCAAGAGCTATC No data
Right 1112231128 13:97590187-97590209 GAGTAGTTATCTGCAGAAGATGG 0: 178
1: 192
2: 102
3: 110
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112231126 Original CRISPR GATAGCTCTTGGTTTGTTAC TGG (reversed) Intergenic
No off target data available for this crispr