ID: 1112234779

View in Genome Browser
Species Human (GRCh38)
Location 13:97625406-97625428
Sequence TGGGAAGCAGCACTGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112234779_1112234785 -3 Left 1112234779 13:97625406-97625428 CCATCCACCAGTGCTGCTTCCCA No data
Right 1112234785 13:97625426-97625448 CCAGCAGCGGTGCTCAACCTTGG No data
1112234779_1112234788 21 Left 1112234779 13:97625406-97625428 CCATCCACCAGTGCTGCTTCCCA No data
Right 1112234788 13:97625450-97625472 CGCACATTAGAATCACTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112234779 Original CRISPR TGGGAAGCAGCACTGGTGGA TGG (reversed) Intergenic
No off target data available for this crispr