ID: 1112239210

View in Genome Browser
Species Human (GRCh38)
Location 13:97664377-97664399
Sequence ATGCTCCCCCTTAAGATGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112239205_1112239210 23 Left 1112239205 13:97664331-97664353 CCAGGGGATGCAAAATCGCTCTG No data
Right 1112239210 13:97664377-97664399 ATGCTCCCCCTTAAGATGTAAGG No data
1112239207_1112239210 -8 Left 1112239207 13:97664362-97664384 CCACTCCTTTAAACCATGCTCCC No data
Right 1112239210 13:97664377-97664399 ATGCTCCCCCTTAAGATGTAAGG No data
1112239204_1112239210 24 Left 1112239204 13:97664330-97664352 CCCAGGGGATGCAAAATCGCTCT No data
Right 1112239210 13:97664377-97664399 ATGCTCCCCCTTAAGATGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112239210 Original CRISPR ATGCTCCCCCTTAAGATGTA AGG Intergenic
No off target data available for this crispr