ID: 1112239357

View in Genome Browser
Species Human (GRCh38)
Location 13:97665669-97665691
Sequence CTGGAGAACAAGAGTGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112239349_1112239357 29 Left 1112239349 13:97665617-97665639 CCCTGAGAGGTGGATGTCAGGGA No data
Right 1112239357 13:97665669-97665691 CTGGAGAACAAGAGTGAAGAGGG No data
1112239350_1112239357 28 Left 1112239350 13:97665618-97665640 CCTGAGAGGTGGATGTCAGGGAG No data
Right 1112239357 13:97665669-97665691 CTGGAGAACAAGAGTGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112239357 Original CRISPR CTGGAGAACAAGAGTGAAGA GGG Intergenic
No off target data available for this crispr