ID: 1112241263

View in Genome Browser
Species Human (GRCh38)
Location 13:97683859-97683881
Sequence CAAGACACCGTGGCCAATAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112241263_1112241269 7 Left 1112241263 13:97683859-97683881 CCCGTATTGGCCACGGTGTCTTG No data
Right 1112241269 13:97683889-97683911 AGGTGTCAGTTTCTGTTTAGTGG No data
1112241263_1112241270 28 Left 1112241263 13:97683859-97683881 CCCGTATTGGCCACGGTGTCTTG No data
Right 1112241270 13:97683910-97683932 GGTTGCCCCCTTACAGTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112241263 Original CRISPR CAAGACACCGTGGCCAATAC GGG (reversed) Intergenic
No off target data available for this crispr