ID: 1112242795

View in Genome Browser
Species Human (GRCh38)
Location 13:97698681-97698703
Sequence CAACTTTAGCAACTAGACTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112242795_1112242797 -4 Left 1112242795 13:97698681-97698703 CCACAGTCTAGTTGCTAAAGTTG No data
Right 1112242797 13:97698700-97698722 GTTGGTTCCCGTAAGAGCAGAGG No data
1112242795_1112242800 30 Left 1112242795 13:97698681-97698703 CCACAGTCTAGTTGCTAAAGTTG No data
Right 1112242800 13:97698734-97698756 GAAAATGCTCTCCGTGTACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112242795 Original CRISPR CAACTTTAGCAACTAGACTG TGG (reversed) Intergenic
No off target data available for this crispr