ID: 1112245008

View in Genome Browser
Species Human (GRCh38)
Location 13:97725309-97725331
Sequence CAGTGTTATTAAAGGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112245005_1112245008 -2 Left 1112245005 13:97725288-97725310 CCGCATGACTGTTGGATAATACA No data
Right 1112245008 13:97725309-97725331 CAGTGTTATTAAAGGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112245008 Original CRISPR CAGTGTTATTAAAGGGAAGA AGG Intergenic
No off target data available for this crispr