ID: 1112245329

View in Genome Browser
Species Human (GRCh38)
Location 13:97728299-97728321
Sequence GGCTTGCCACAATTTCAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112245329_1112245334 11 Left 1112245329 13:97728299-97728321 CCTGGCTGAAATTGTGGCAAGCC No data
Right 1112245334 13:97728333-97728355 CTCTCTCTCCTTCCCCTCGGTGG No data
1112245329_1112245333 8 Left 1112245329 13:97728299-97728321 CCTGGCTGAAATTGTGGCAAGCC No data
Right 1112245333 13:97728330-97728352 CCTCTCTCTCTCCTTCCCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112245329 Original CRISPR GGCTTGCCACAATTTCAGCC AGG (reversed) Intergenic
No off target data available for this crispr