ID: 1112247747

View in Genome Browser
Species Human (GRCh38)
Location 13:97749933-97749955
Sequence CCCAGCCAACTCTAAATTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112247747_1112247755 9 Left 1112247747 13:97749933-97749955 CCTAAAATTTAGAGTTGGCTGGG No data
Right 1112247755 13:97749965-97749987 GGGTTGCCTGGGGATCCCATGGG No data
1112247747_1112247753 -1 Left 1112247747 13:97749933-97749955 CCTAAAATTTAGAGTTGGCTGGG No data
Right 1112247753 13:97749955-97749977 GCAGAAGCATGGGTTGCCTGGGG No data
1112247747_1112247752 -2 Left 1112247747 13:97749933-97749955 CCTAAAATTTAGAGTTGGCTGGG No data
Right 1112247752 13:97749954-97749976 GGCAGAAGCATGGGTTGCCTGGG No data
1112247747_1112247751 -3 Left 1112247747 13:97749933-97749955 CCTAAAATTTAGAGTTGGCTGGG No data
Right 1112247751 13:97749953-97749975 GGGCAGAAGCATGGGTTGCCTGG No data
1112247747_1112247754 8 Left 1112247747 13:97749933-97749955 CCTAAAATTTAGAGTTGGCTGGG No data
Right 1112247754 13:97749964-97749986 TGGGTTGCCTGGGGATCCCATGG No data
1112247747_1112247757 16 Left 1112247747 13:97749933-97749955 CCTAAAATTTAGAGTTGGCTGGG No data
Right 1112247757 13:97749972-97749994 CTGGGGATCCCATGGGCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112247747 Original CRISPR CCCAGCCAACTCTAAATTTT AGG (reversed) Intergenic
No off target data available for this crispr