ID: 1112249823

View in Genome Browser
Species Human (GRCh38)
Location 13:97769484-97769506
Sequence GTGGTCAATGACAGGGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112249815_1112249823 -6 Left 1112249815 13:97769467-97769489 CCTCCATCCCTGTTACCGTGGTC No data
Right 1112249823 13:97769484-97769506 GTGGTCAATGACAGGGTGGCTGG No data
1112249812_1112249823 5 Left 1112249812 13:97769456-97769478 CCCATGTGTAACCTCCATCCCTG 0: 62
1: 127
2: 173
3: 180
4: 317
Right 1112249823 13:97769484-97769506 GTGGTCAATGACAGGGTGGCTGG No data
1112249813_1112249823 4 Left 1112249813 13:97769457-97769479 CCATGTGTAACCTCCATCCCTGT No data
Right 1112249823 13:97769484-97769506 GTGGTCAATGACAGGGTGGCTGG No data
1112249816_1112249823 -9 Left 1112249816 13:97769470-97769492 CCATCCCTGTTACCGTGGTCAAT No data
Right 1112249823 13:97769484-97769506 GTGGTCAATGACAGGGTGGCTGG No data
1112249811_1112249823 18 Left 1112249811 13:97769443-97769465 CCATGTTGCTGAGCCCATGTGTA 0: 57
1: 119
2: 200
3: 206
4: 311
Right 1112249823 13:97769484-97769506 GTGGTCAATGACAGGGTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112249823 Original CRISPR GTGGTCAATGACAGGGTGGC TGG Intergenic
No off target data available for this crispr