ID: 1112249926

View in Genome Browser
Species Human (GRCh38)
Location 13:97770267-97770289
Sequence GACAGCTCTTGGGCTGTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112249926_1112249930 11 Left 1112249926 13:97770267-97770289 CCAGTAACAGCCCAAGAGCTGTC No data
Right 1112249930 13:97770301-97770323 GAGTAATTATCTGCAGAAGATGG No data
1112249926_1112249932 16 Left 1112249926 13:97770267-97770289 CCAGTAACAGCCCAAGAGCTGTC No data
Right 1112249932 13:97770306-97770328 ATTATCTGCAGAAGATGGCAGGG No data
1112249926_1112249931 15 Left 1112249926 13:97770267-97770289 CCAGTAACAGCCCAAGAGCTGTC No data
Right 1112249931 13:97770305-97770327 AATTATCTGCAGAAGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112249926 Original CRISPR GACAGCTCTTGGGCTGTTAC TGG (reversed) Intergenic
No off target data available for this crispr