ID: 1112249931

View in Genome Browser
Species Human (GRCh38)
Location 13:97770305-97770327
Sequence AATTATCTGCAGAAGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112249925_1112249931 16 Left 1112249925 13:97770266-97770288 CCCAGTAACAGCCCAAGAGCTGT No data
Right 1112249931 13:97770305-97770327 AATTATCTGCAGAAGATGGCAGG No data
1112249924_1112249931 25 Left 1112249924 13:97770257-97770279 CCACGAAAGCCCAGTAACAGCCC No data
Right 1112249931 13:97770305-97770327 AATTATCTGCAGAAGATGGCAGG No data
1112249926_1112249931 15 Left 1112249926 13:97770267-97770289 CCAGTAACAGCCCAAGAGCTGTC No data
Right 1112249931 13:97770305-97770327 AATTATCTGCAGAAGATGGCAGG No data
1112249929_1112249931 4 Left 1112249929 13:97770278-97770300 CCAAGAGCTGTCTCTCAAAAGGA 0: 181
1: 197
2: 163
3: 130
4: 293
Right 1112249931 13:97770305-97770327 AATTATCTGCAGAAGATGGCAGG No data
1112249927_1112249931 5 Left 1112249927 13:97770277-97770299 CCCAAGAGCTGTCTCTCAAAAGG No data
Right 1112249931 13:97770305-97770327 AATTATCTGCAGAAGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112249931 Original CRISPR AATTATCTGCAGAAGATGGC AGG Intergenic
No off target data available for this crispr