ID: 1112251123

View in Genome Browser
Species Human (GRCh38)
Location 13:97781683-97781705
Sequence GCCCTTGATAACTTACTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112251123_1112251131 4 Left 1112251123 13:97781683-97781705 CCAGAGAGTAAGTTATCAAGGGC No data
Right 1112251131 13:97781710-97781732 CCTAGAGCAGGGCTGGGTCAGGG No data
1112251123_1112251126 -3 Left 1112251123 13:97781683-97781705 CCAGAGAGTAAGTTATCAAGGGC No data
Right 1112251126 13:97781703-97781725 GGCCTATCCTAGAGCAGGGCTGG No data
1112251123_1112251132 5 Left 1112251123 13:97781683-97781705 CCAGAGAGTAAGTTATCAAGGGC No data
Right 1112251132 13:97781711-97781733 CTAGAGCAGGGCTGGGTCAGGGG No data
1112251123_1112251136 30 Left 1112251123 13:97781683-97781705 CCAGAGAGTAAGTTATCAAGGGC No data
Right 1112251136 13:97781736-97781758 GATGGAAGGAGAAGTTCCCCAGG No data
1112251123_1112251127 -2 Left 1112251123 13:97781683-97781705 CCAGAGAGTAAGTTATCAAGGGC No data
Right 1112251127 13:97781704-97781726 GCCTATCCTAGAGCAGGGCTGGG No data
1112251123_1112251133 8 Left 1112251123 13:97781683-97781705 CCAGAGAGTAAGTTATCAAGGGC No data
Right 1112251133 13:97781714-97781736 GAGCAGGGCTGGGTCAGGGGAGG No data
1112251123_1112251125 -7 Left 1112251123 13:97781683-97781705 CCAGAGAGTAAGTTATCAAGGGC No data
Right 1112251125 13:97781699-97781721 CAAGGGCCTATCCTAGAGCAGGG No data
1112251123_1112251135 16 Left 1112251123 13:97781683-97781705 CCAGAGAGTAAGTTATCAAGGGC No data
Right 1112251135 13:97781722-97781744 CTGGGTCAGGGGAGGATGGAAGG No data
1112251123_1112251134 12 Left 1112251123 13:97781683-97781705 CCAGAGAGTAAGTTATCAAGGGC No data
Right 1112251134 13:97781718-97781740 AGGGCTGGGTCAGGGGAGGATGG No data
1112251123_1112251124 -8 Left 1112251123 13:97781683-97781705 CCAGAGAGTAAGTTATCAAGGGC No data
Right 1112251124 13:97781698-97781720 TCAAGGGCCTATCCTAGAGCAGG No data
1112251123_1112251129 3 Left 1112251123 13:97781683-97781705 CCAGAGAGTAAGTTATCAAGGGC No data
Right 1112251129 13:97781709-97781731 TCCTAGAGCAGGGCTGGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112251123 Original CRISPR GCCCTTGATAACTTACTCTC TGG (reversed) Intergenic
No off target data available for this crispr