ID: 1112251128

View in Genome Browser
Species Human (GRCh38)
Location 13:97781705-97781727
Sequence ACCCAGCCCTGCTCTAGGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112251128_1112251135 -6 Left 1112251128 13:97781705-97781727 CCTATCCTAGAGCAGGGCTGGGT No data
Right 1112251135 13:97781722-97781744 CTGGGTCAGGGGAGGATGGAAGG No data
1112251128_1112251143 30 Left 1112251128 13:97781705-97781727 CCTATCCTAGAGCAGGGCTGGGT No data
Right 1112251143 13:97781758-97781780 GATATCATAAGGGATGGAGTTGG No data
1112251128_1112251134 -10 Left 1112251128 13:97781705-97781727 CCTATCCTAGAGCAGGGCTGGGT No data
Right 1112251134 13:97781718-97781740 AGGGCTGGGTCAGGGGAGGATGG No data
1112251128_1112251136 8 Left 1112251128 13:97781705-97781727 CCTATCCTAGAGCAGGGCTGGGT No data
Right 1112251136 13:97781736-97781758 GATGGAAGGAGAAGTTCCCCAGG No data
1112251128_1112251138 20 Left 1112251128 13:97781705-97781727 CCTATCCTAGAGCAGGGCTGGGT No data
Right 1112251138 13:97781748-97781770 AGTTCCCCAGGATATCATAAGGG No data
1112251128_1112251140 24 Left 1112251128 13:97781705-97781727 CCTATCCTAGAGCAGGGCTGGGT No data
Right 1112251140 13:97781752-97781774 CCCCAGGATATCATAAGGGATGG No data
1112251128_1112251137 19 Left 1112251128 13:97781705-97781727 CCTATCCTAGAGCAGGGCTGGGT No data
Right 1112251137 13:97781747-97781769 AAGTTCCCCAGGATATCATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112251128 Original CRISPR ACCCAGCCCTGCTCTAGGAT AGG (reversed) Intergenic
No off target data available for this crispr