ID: 1112251135

View in Genome Browser
Species Human (GRCh38)
Location 13:97781722-97781744
Sequence CTGGGTCAGGGGAGGATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112251128_1112251135 -6 Left 1112251128 13:97781705-97781727 CCTATCCTAGAGCAGGGCTGGGT No data
Right 1112251135 13:97781722-97781744 CTGGGTCAGGGGAGGATGGAAGG No data
1112251123_1112251135 16 Left 1112251123 13:97781683-97781705 CCAGAGAGTAAGTTATCAAGGGC No data
Right 1112251135 13:97781722-97781744 CTGGGTCAGGGGAGGATGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112251135 Original CRISPR CTGGGTCAGGGGAGGATGGA AGG Intergenic
No off target data available for this crispr