ID: 1112262502

View in Genome Browser
Species Human (GRCh38)
Location 13:97890048-97890070
Sequence GGCAGGAAGCCCAACAGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112262500_1112262502 -10 Left 1112262500 13:97890035-97890057 CCTGAAGGATGATGGCAGGAAGC No data
Right 1112262502 13:97890048-97890070 GGCAGGAAGCCCAACAGGAGAGG No data
1112262494_1112262502 23 Left 1112262494 13:97890002-97890024 CCACTCAGAGGAACTGAGACATT No data
Right 1112262502 13:97890048-97890070 GGCAGGAAGCCCAACAGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112262502 Original CRISPR GGCAGGAAGCCCAACAGGAG AGG Intergenic
No off target data available for this crispr