ID: 1112265581

View in Genome Browser
Species Human (GRCh38)
Location 13:97920377-97920399
Sequence CTATTAACACAGGTGAGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112265581_1112265586 -7 Left 1112265581 13:97920377-97920399 CCCAGCCTCACCTGTGTTAATAG No data
Right 1112265586 13:97920393-97920415 TTAATAGTGTTAACACAGATGGG No data
1112265581_1112265585 -8 Left 1112265581 13:97920377-97920399 CCCAGCCTCACCTGTGTTAATAG No data
Right 1112265585 13:97920392-97920414 GTTAATAGTGTTAACACAGATGG No data
1112265581_1112265587 14 Left 1112265581 13:97920377-97920399 CCCAGCCTCACCTGTGTTAATAG No data
Right 1112265587 13:97920414-97920436 GGCTCTCAAGTCAAAATGCTTGG No data
1112265581_1112265588 15 Left 1112265581 13:97920377-97920399 CCCAGCCTCACCTGTGTTAATAG No data
Right 1112265588 13:97920415-97920437 GCTCTCAAGTCAAAATGCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112265581 Original CRISPR CTATTAACACAGGTGAGGCT GGG (reversed) Intergenic
No off target data available for this crispr