ID: 1112267588

View in Genome Browser
Species Human (GRCh38)
Location 13:97939314-97939336
Sequence CTGCATGCACAGATGCACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112267588_1112267592 13 Left 1112267588 13:97939314-97939336 CCCTGGTGCATCTGTGCATGCAG No data
Right 1112267592 13:97939350-97939372 ATACCCAGGAAATAAGCTGCAGG 0: 1
1: 0
2: 0
3: 35
4: 254
1112267588_1112267597 22 Left 1112267588 13:97939314-97939336 CCCTGGTGCATCTGTGCATGCAG No data
Right 1112267597 13:97939359-97939381 AAATAAGCTGCAGGCTCCTGGGG 0: 1
1: 0
2: 1
3: 18
4: 163
1112267588_1112267595 20 Left 1112267588 13:97939314-97939336 CCCTGGTGCATCTGTGCATGCAG No data
Right 1112267595 13:97939357-97939379 GGAAATAAGCTGCAGGCTCCTGG 0: 1
1: 0
2: 4
3: 23
4: 187
1112267588_1112267596 21 Left 1112267588 13:97939314-97939336 CCCTGGTGCATCTGTGCATGCAG No data
Right 1112267596 13:97939358-97939380 GAAATAAGCTGCAGGCTCCTGGG 0: 1
1: 0
2: 1
3: 11
4: 155
1112267588_1112267590 -1 Left 1112267588 13:97939314-97939336 CCCTGGTGCATCTGTGCATGCAG No data
Right 1112267590 13:97939336-97939358 GATTTCCAGAGAATATACCCAGG 0: 1
1: 0
2: 0
3: 11
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112267588 Original CRISPR CTGCATGCACAGATGCACCA GGG (reversed) Intergenic
No off target data available for this crispr