ID: 1112271902

View in Genome Browser
Species Human (GRCh38)
Location 13:97976480-97976502
Sequence CCCGCCGCGGCCGCCGGCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1270
Summary {0: 1, 1: 0, 2: 14, 3: 215, 4: 1040}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112271902_1112271908 -7 Left 1112271902 13:97976480-97976502 CCGGCGCCGGCGGCCGCGGCGGG 0: 1
1: 0
2: 14
3: 215
4: 1040
Right 1112271908 13:97976496-97976518 CGGCGGGGTGAGAGGCCGCGAGG 0: 1
1: 0
2: 1
3: 23
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112271902 Original CRISPR CCCGCCGCGGCCGCCGGCGC CGG (reversed) Intronic
900091748 1:923865-923887 CCCGGCGCGGCGGGCGGCGCGGG - Intergenic
900113269 1:1018533-1018555 CCCTCCGCAGCCGCTGGCCCGGG + Intergenic
900117433 1:1034558-1034580 GCCTCCGCTGCCGCTGGCGCGGG + Intronic
900180127 1:1307653-1307675 CGGGCCGCGGCCGCCGGGGAGGG - Intronic
900249299 1:1658929-1658951 GCTGCCGCCGCCGCCGCCGCCGG + Exonic
900249301 1:1658935-1658957 GCCGCCGCCGCCGCCGGTCCCGG + Exonic
900633819 1:3652241-3652263 CCCGGCGAGGCCGCCCACGCAGG - Intronic
901433932 1:9234856-9234878 CCCGCGGCGGCCGCAGGGGAAGG - Exonic
901577181 1:10210522-10210544 CCGCCCGCAGTCGCCGGCGCGGG - Intergenic
901629012 1:10639210-10639232 GCCGCCGCCGCCGCCGCAGCTGG - Exonic
902067466 1:13700212-13700234 GGCGGCGCGGCCGCGGGCGCCGG + Intronic
902067469 1:13700218-13700240 GCGGCCGCGGGCGCCGGGGCCGG + Intronic
902323643 1:15684489-15684511 CCCGCCGCCGCTTCCCGCGCCGG - Exonic
902600945 1:17539856-17539878 CCCGCGGCGGCCTGCGGAGCTGG + Exonic
903115521 1:21176259-21176281 GCCGCCGCTGCTGCCGCCGCCGG + Exonic
903115634 1:21176590-21176612 GCCTCCGCCGCCGCCGCCGCCGG + Intronic
903324741 1:22563450-22563472 GCCGCCGCCGCCGCCGCCCCGGG - Intergenic
903652324 1:24929785-24929807 CTTGCCGCCGCCGCCGCCGCAGG + Exonic
903652366 1:24929914-24929936 CCCCCGGGGGCGGCCGGCGCGGG + Intronic
903652479 1:24930277-24930299 GGGGCCGCGGCCGCCCGCGCGGG + Intronic
903829120 1:26164414-26164436 GCCGCCGCCGCCGCCTGCGAGGG + Intergenic
903907389 1:26696448-26696470 CCCGCCGCCGCCGCCGCCCTCGG + Exonic
903986892 1:27234975-27234997 CCCTCCGCGGGCGCCGAGGCGGG + Intronic
904039292 1:27575173-27575195 CCCGCCGCCGCCGCCGCCTCTGG + Intronic
904500199 1:30908782-30908804 TGCGCCGCCGCCGCCGCCGCCGG + Intergenic
904620452 1:31772031-31772053 CGCGCCGCCGCCGCCGCCACGGG - Intergenic
904642012 1:31938138-31938160 GCCGCCGCCGCCGCCGGGCCGGG - Exonic
904642016 1:31938144-31938166 CGCGCCGCCGCCGCCGCCGCCGG - Exonic
904783000 1:32964593-32964615 GCCGCAGCGGCGGCCGGCGCCGG - Exonic
905369203 1:37474400-37474422 CGCGCAGCGGCCGCGGGGGCGGG + Intergenic
905449224 1:38046414-38046436 TCCGCCGCCGCCGCCGTCGTCGG + Exonic
905546454 1:38804101-38804123 CCCGCTGTGGCCGCTGGCGCCGG + Intergenic
905717091 1:40161421-40161443 GCCGCCGCTGTCGCCGGGGCTGG + Exonic
905867132 1:41382451-41382473 CCCTACGCTGCCGCCGCCGCCGG + Exonic
906204394 1:43979334-43979356 GCCGCCGCCGCCGCCGCCGCGGG - Intronic
906204433 1:43979439-43979461 CCGTCCGCAGCCGCCGGAGCCGG + Intronic
906480950 1:46198470-46198492 GCCGCCGCCGCCGCTGCCGCGGG + Intronic
906637014 1:47416489-47416511 GCCGCCGCCGCCGCCGCCCCGGG - Exonic
906637074 1:47416832-47416854 GGCGCCGCGGCCGCGTGCGCGGG - Exonic
906960919 1:50419098-50419120 GCCGCCGCCGCCGCCGCCGGGGG - Exonic
906960923 1:50419101-50419123 GCCGCCGCCGCCGCCGCCGCCGG - Exonic
907010628 1:50959889-50959911 GCCACCGCCGCCGCCGCCGCCGG + Exonic
907213523 1:52843019-52843041 CTCGCCGCGCTCGCCGGAGCTGG - Intronic
907278112 1:53328031-53328053 GCCGCCGCTGCCGCCCGCCCCGG + Intronic
907430053 1:54406369-54406391 GCCGCCGCCGCCGCCGCCGCTGG + Exonic
908027748 1:59969886-59969908 CCCTCCGCAGCCGCTGGCCCGGG + Intergenic
910034763 1:82777003-82777025 CCCTCCGCAGCCGCTGGCCCGGG + Intergenic
910237338 1:85048754-85048776 TCCGGAGCTGCCGCCGGCGCCGG + Intronic
910759000 1:90717596-90717618 GCCGCCGCCGCCGCCGCTGCCGG + Intergenic
911078973 1:93909391-93909413 CCCGCTGCGGCCGCAGTAGCCGG - Exonic
911205926 1:95091505-95091527 CCCTCCGCAGCCGCTGGCCCAGG - Intergenic
911839247 1:102660234-102660256 CCCTCCGCAGCCGCTGGCCCGGG + Intergenic
912879137 1:113390982-113391004 GGCGCCCCGGCCGCCCGCGCGGG + Exonic
913161855 1:116152296-116152318 CCCGCCGCCTCCGCCCACGCTGG + Intergenic
913518269 1:119623306-119623328 CACGCGGCGGCCAGCGGCGCGGG - Exonic
913615719 1:120558170-120558192 GCCGCCGCCGCCGCCGCCTCGGG - Intergenic
914001719 1:143699944-143699966 CCCGCTGCGGGAGCCGGCGGAGG + Intergenic
914244044 1:145872806-145872828 CCCGCTGCAGCCGCTGGCTCAGG + Exonic
914244372 1:145874822-145874844 CGCCCCGCCGCCGCCGGCTCAGG + Exonic
914428599 1:147600194-147600216 GCCGCCGCCGCTGCCGCCGCCGG + Intronic
914428603 1:147600197-147600219 GCCGCCGCTGCCGCCGCCGGGGG + Intronic
914428611 1:147600230-147600252 GCCGCCGCTGCCGCTGGCCCCGG + Intronic
914514565 1:148362851-148362873 CCCGCTGCGGGAGCCGGCGGAGG + Intergenic
914574557 1:148952732-148952754 GCCGCCGCCGCCGCCGCCTCGGG + Intronic
915070480 1:153261638-153261660 TCCGCCGCTGCCGCCGCCGCCGG - Exonic
915260057 1:154670889-154670911 CCCTCCGCAGCCGCTGGCCCAGG - Intergenic
915261227 1:154678176-154678198 CCCTCCGCAGCCGCTGGCCCGGG - Intergenic
915313289 1:155015253-155015275 CCCGCCGCAGCCGCAAGCCCCGG + Exonic
915326077 1:155081934-155081956 GCCGCCGCCGCCGCTGTCGCAGG + Intronic
915519904 1:156436122-156436144 CCCGCCGCGCCCGCGGCCGGAGG - Intergenic
915616895 1:157045942-157045964 CACGCCGCGGCGGCCGGGGGCGG + Intergenic
915666108 1:157446504-157446526 CCCTCCGCAGCCGCTGGCCCGGG + Intergenic
915764489 1:158349211-158349233 CCCTCCGCAGCCGCTGGCCCGGG + Intergenic
915767158 1:158374376-158374398 CCCTCCGCAGCCGCTGGCCCGGG + Intergenic
916052410 1:161045610-161045632 CGCGCCGCAGCCGCCGGCACCGG - Intronic
916219868 1:162433291-162433313 CCCTCCGCAGCCGCTGGCCCGGG - Intergenic
916783015 1:168056464-168056486 CCCGCCCCGCCTCCCGGCGCGGG - Intronic
917578544 1:176349492-176349514 CCCTCCGCAGCCGCTGGCCCGGG + Intergenic
918059008 1:181045968-181045990 CCCTCCGCAGCCGCTGGCCCGGG - Intronic
918066486 1:181105276-181105298 GCAGCCGCGGGCGCCGGCGCAGG - Intergenic
918282959 1:183023576-183023598 GCCGCCGCCACCGCCCGCGCCGG + Exonic
918628075 1:186680876-186680898 CCCGCCGCCGCCGCCGTGTCTGG + Intergenic
920705008 1:208244297-208244319 GCCGCCGCCGCCGCCACCGCGGG - Exonic
920705038 1:208244416-208244438 CCGGCCGCGTCCGCCCGGGCTGG + Intergenic
921039507 1:211416578-211416600 CCCGCGCGGGCCGCAGGCGCCGG + Intergenic
921472722 1:215567713-215567735 CCCGCGGCGGCGGCCGGCAGCGG + Exonic
921903833 1:220475891-220475913 CCCCCCGCAGCCGCTGGCCCGGG + Intergenic
922485428 1:225969904-225969926 CCCTCCGCAGCCGCTGGCCCGGG - Intergenic
922499071 1:226083592-226083614 CCCCACGCGGCCGCCTGCACAGG + Intergenic
922541910 1:226426514-226426536 CCCTCCGCAGCCGCTGGCCCGGG + Intergenic
922730843 1:227948093-227948115 CCGGCCGCCGCTCCCGGCGCGGG + Intergenic
922753738 1:228082873-228082895 CCTGTCGCCGCCGCCGCCGCGGG - Intronic
922783319 1:228269979-228270001 CCCGGCGCGGCCGCGGCCGGGGG - Intronic
922958587 1:229625909-229625931 CCCCCCGCCGCCGCCGCCTCCGG + Exonic
923157230 1:231289697-231289719 CCCTCCGCAGCCGCTGGCCCAGG + Intergenic
923191775 1:231626895-231626917 CCAGCCGCCGCCGGCGGCGGCGG + Exonic
923191776 1:231626899-231626921 CACGCCGCCGCCGCCGGCGGCGG - Exonic
923369457 1:233295677-233295699 CCGGCCGCAGCAGCCGGCTCCGG - Exonic
924117522 1:240762627-240762649 TCCTCCGCAGCCGCCGGCCCGGG - Intergenic
924172419 1:241356684-241356706 GCCGCGGCGGCCGCCGGAGCCGG + Intronic
924198980 1:241640258-241640280 CCCGCCAGGCGCGCCGGCGCCGG - Exonic
924289722 1:242524714-242524736 CCCGCCGCCGCCGCCGCCCCGGG - Intergenic
924415063 1:243850039-243850061 ACCGCCGCCGCCGCCGTTGCAGG - Intronic
924436681 1:244048904-244048926 CCGGCCGCCGCCGCCGCCGCCGG - Intergenic
924754787 1:246931493-246931515 GCCGCCGCCGCCGCCGCCGCGGG + Intronic
1062874031 10:931319-931341 CCCGCCGCGGCCGCGTCCTCCGG + Intronic
1062874222 10:931986-932008 CCCGCCCCGCCCGCCGTCCCCGG + Intergenic
1063318728 10:5032740-5032762 CCCTCCGCAGCCGCTGGCCCGGG + Intronic
1063995050 10:11611386-11611408 CCCGCGGAGCCCGCCGCCGCCGG + Intronic
1064209078 10:13348112-13348134 CCCGCCGCCGCCGCCGCCGCCGG - Exonic
1064274199 10:13891772-13891794 CCCGCCGCCGCCCCCGCCGCGGG + Intronic
1064981872 10:21173845-21173867 GCCGCCGCCGCCGCCGCCCCCGG - Intronic
1065024202 10:21526065-21526087 CCCGCCCCCGCCGCCAGCCCCGG + Intergenic
1065092940 10:22252821-22252843 CCCGCCGCGGCGCCTGGCCCAGG + Intergenic
1065140461 10:22714415-22714437 CGCGCCGGGGCCGCCGCCGGGGG - Exonic
1065637561 10:27746050-27746072 CCCGCCGAGTCCTCCGGAGCCGG + Exonic
1065687705 10:28302759-28302781 CTCGGCCCGGTCGCCGGCGCAGG + Intronic
1065712734 10:28533158-28533180 CCCGCCGCCGCCGCCGCCGCTGG - Intronic
1066022738 10:31319445-31319467 CCCTCCGCTGCCGCCGCTGCCGG + Intronic
1066402609 10:35090355-35090377 CCGGCCGCCGCCACCGGCCCCGG + Exonic
1066464802 10:35641985-35642007 CAAGCCGCCGCCGCCGCCGCCGG + Exonic
1066464804 10:35641991-35642013 GCCGCCGCCGCCGCCGGAGTTGG + Exonic
1068538612 10:58267839-58267861 GCCGCCGCAGCCGCCGGCCCCGG + Exonic
1068863173 10:61867783-61867805 CCCTCCGCAGCCGCTGGCCCGGG - Intergenic
1069019186 10:63466135-63466157 GCCGCCGCCGCCGCCGCCTCTGG - Intergenic
1069526925 10:69180512-69180534 CCCGACGTCGCCGTCGGCGCTGG - Exonic
1069673939 10:70233600-70233622 CACGTGGCTGCCGCCGGCGCTGG + Intronic
1069988676 10:72300730-72300752 CCCTCCGCAGCCGCTGGCCCGGG - Intergenic
1069992975 10:72326092-72326114 CCCTCCGCAGCCGCTGGCCCGGG - Intergenic
1070800833 10:79243558-79243580 CCCCGCGCCGCCGCCGCCGCCGG + Intronic
1071086644 10:81874603-81874625 CGCGCCGCTGCCGCCGCCGCCGG - Intergenic
1071086829 10:81875254-81875276 CCGGGCGCGGGCGCGGGCGCGGG - Intergenic
1071309365 10:84328527-84328549 CCCGCCGCGGGCCCGTGCGCAGG - Intergenic
1071695356 10:87863795-87863817 GCCGCCGCTGCCGCCGCCGCAGG - Exonic
1071997520 10:91162878-91162900 AGCGCCGCCGCCGCCGCCGCGGG + Intergenic
1071997555 10:91162973-91162995 CGCCCCGCCCCCGCCGGCGCGGG + Intergenic
1072003633 10:91221031-91221053 CCGGCTGCGGACGCCGGCCCCGG + Intronic
1072070279 10:91908752-91908774 CCCGCTGCGGCCTCCGGGGCGGG + Exonic
1072089634 10:92115040-92115062 GCCCCGGCGGCCGCGGGCGCGGG + Intronic
1072151683 10:92689696-92689718 CCCGCCGCGGCTGTCGCCCCTGG - Intergenic
1072409071 10:95183876-95183898 CCTGCCGCCGCCGCCGCCCCGGG + Intergenic
1072784051 10:98268374-98268396 CCAGCCGCAGCCGGCGGGGCCGG + Intergenic
1073036870 10:100570053-100570075 CCCGCCGCAGCCGCCCGCCCTGG - Intergenic
1073051656 10:100671120-100671142 CCCGCCGCCTCCGCCGGGGCCGG + Intergenic
1073051702 10:100671269-100671291 CCACCCGAGGCCGCCGGCTCCGG + Intergenic
1073082082 10:100866737-100866759 CCTGCCGCTGCCGCCCGCCCGGG + Intergenic
1073136835 10:101224874-101224896 CCCCCCGCGGCTCCCGGTGCGGG - Intergenic
1073249800 10:102114593-102114615 CCCGCGGCGGCCGCTGTCCCGGG + Intronic
1073325978 10:102644170-102644192 GCCGCCGCTGCCGCCGCCGCCGG + Intergenic
1073432171 10:103493928-103493950 GCCGCCGCGGCCGTCTCCGCGGG + Intergenic
1073789770 10:106928325-106928347 CCCTCCGCAGCCGCTGGCCCGGG + Intronic
1074169721 10:110919955-110919977 CCGCCCGCCGCCGCCGCCGCAGG - Intronic
1074314592 10:112349871-112349893 CCCTCCGCAGCCGCTGGCCCAGG - Intergenic
1074503472 10:114045472-114045494 CCCGCCGTTGCAGCCGGCCCAGG - Exonic
1074865721 10:117543424-117543446 TCGGCCGCCGCCGCCGCCGCCGG + Exonic
1074996338 10:118760369-118760391 CCCTCCGCCGCCGCCAGCCCAGG + Intergenic
1075054586 10:119207810-119207832 GCCGCCGCTGCTGCCGGAGCCGG - Exonic
1075255625 10:120923963-120923985 CCCTCCGCAGCCGCTGGCCCGGG - Intergenic
1075269376 10:121035561-121035583 CCCTCCGCAGCCGCTGGCCCGGG + Intergenic
1075334206 10:121597382-121597404 CCCGCAGCCGCCGTCGGCGCTGG - Intronic
1075430237 10:122374539-122374561 CGCGCCGAGGCCGCCGCCGCTGG + Intergenic
1075537525 10:123283575-123283597 CCCTCCGCAGCCGCCGGCCCGGG + Intergenic
1075645057 10:124091893-124091915 CCAGCCGCGCCGGCCGGCCCCGG + Intronic
1075877915 10:125823167-125823189 GCCGCGGCGGCCACCCGCGCCGG + Exonic
1076279786 10:129236629-129236651 GCCGCCGCTTCCTCCGGCGCTGG - Intergenic
1076554237 10:131311644-131311666 CCCGCCGCCGCCGTCAGCGCGGG - Exonic
1076638909 10:131901014-131901036 GCCGCCGCCGCCGCCGGGGAGGG - Exonic
1076638915 10:131901020-131901042 GCCGCCGCCGCCGCCGCCGCCGG - Exonic
1076721969 10:132396833-132396855 CCCGCCGCGGCCGGAGCCCCGGG - Intergenic
1076722087 10:132397163-132397185 GCCGCCGCCGCCGCCGCCGCCGG - Exonic
1076750014 10:132537799-132537821 CCCGCAGCCGCCGCCGACTCAGG - Exonic
1076792812 10:132785950-132785972 GGCGCCGCCGCCGCCGGCCCGGG + Exonic
1076998614 11:311203-311225 CCCCTGGCGGCGGCCGGCGCAGG + Intronic
1077000129 11:318556-318578 CCCCTGGCGGCGGCCGGCGCAGG - Intergenic
1077044080 11:536819-536841 CCCGCCTCGCCCTCCTGCGCCGG + Intronic
1077152479 11:1078475-1078497 CCCGGGCCGGCCGCCGGCGTGGG - Intergenic
1077234241 11:1472257-1472279 CCCACAGCGGCCGCCCCCGCAGG + Intronic
1077495289 11:2884247-2884269 CCCGCCGCGGACCTCGGCGCGGG - Intronic
1077956003 11:7020482-7020504 CCCGCAGCTCCCGCCCGCGCAGG - Exonic
1078474911 11:11621953-11621975 ACCGCCAAGGCAGCCGGCGCTGG - Exonic
1078659825 11:13277858-13277880 CTCACCGCCGCCGCCGCCGCGGG + Exonic
1079450779 11:20598292-20598314 GCGGCCGCGGCCGCAGGCGTAGG - Intergenic
1079450781 11:20598298-20598320 GCCGCGGCGGCCGCGGCCGCAGG - Intergenic
1079689406 11:23403535-23403557 CGCGCCGCCGCCGCCGCCGCGGG + Intergenic
1081428389 11:42950024-42950046 CCCTCCGCAGCCGCTGGCCCGGG - Intergenic
1081700146 11:45147365-45147387 CCCGCAGCAGCCCCCGGCGCGGG - Exonic
1081831507 11:46119970-46119992 CGCCCCGCGGCCGCCGGCGGCGG + Intronic
1081831512 11:46119973-46119995 CCCGCGGCCGCCGGCGGCGGGGG + Intronic
1081938192 11:46918705-46918727 CCCGCCGGCGCCTCCTGCGCGGG + Intergenic
1083039127 11:59669081-59669103 CCCTGCGCAGCCGCCGCCGCCGG - Intergenic
1083595549 11:63916967-63916989 GTCGCCGCCGCCGCCGCCGCCGG - Intergenic
1083617980 11:64035832-64035854 CTCGCCGCCGCCGCTCGCGCGGG + Intronic
1083657080 11:64234807-64234829 CCCGCCGGGGCCGCCCGCCGGGG - Exonic
1083747132 11:64742859-64742881 CCTGCCATGGCCGCCGGCGCGGG + Exonic
1083758746 11:64804711-64804733 CCCGCCGTGGGCCCCGCCGCCGG + Exonic
1083807495 11:65083833-65083855 CCCGCTGCCGCCGCCGGAGGAGG - Intronic
1083899803 11:65638145-65638167 CCAGCCGCCGCCGCCCGCGCTGG - Intronic
1083920852 11:65780883-65780905 GCCACCCCGGCCCCCGGCGCCGG + Intergenic
1083970303 11:66070404-66070426 GCCCCCGCCGCCGCCGCCGCGGG + Intronic
1084107412 11:66988933-66988955 CCCTCCGCAGCCGCTGGCCCGGG - Intergenic
1084129037 11:67119341-67119363 GCCGCCGCCGCCGCCGCTGCCGG - Intronic
1084165299 11:67372612-67372634 CCCGCCCCCGCCCCCGCCGCGGG - Intronic
1084546849 11:69818951-69818973 CCTGCAGCCGCCGCCGCCGCGGG - Exonic
1085208066 11:74749048-74749070 GCCGCCGCTGCCGCCGCGGCCGG + Exonic
1085266774 11:75242035-75242057 ACCGCCGCGGCATCCAGCGCTGG + Exonic
1085863132 11:80257701-80257723 CCCTCCGCAGCCGCTGGCCCGGG - Intergenic
1086034907 11:82404040-82404062 CCCTCCGCAGCTGCCGGCCCGGG - Intergenic
1086887837 11:92224977-92224999 GCCGCCGCCGCCGCCGCCGGGGG - Intergenic
1086887840 11:92224980-92225002 GACGCCGCCGCCGCCGCCGCCGG - Intergenic
1087672757 11:101127554-101127576 TCCGCCTCTGCCGCCGCCGCCGG - Exonic
1088570880 11:111222117-111222139 CCCTCCGCAGCCGCTGGCCCGGG - Intergenic
1089062119 11:115634115-115634137 CCCTCCGCAGCCGCTGGCCCGGG + Intergenic
1089273357 11:117316126-117316148 CCCCCGGCGGGCGGCGGCGCGGG + Exonic
1089346855 11:117796548-117796570 CCCGCCGCGGACCCCAGCCCTGG - Intronic
1089432649 11:118436556-118436578 CCCGCCGCCGCCGCCCCCGGTGG - Exonic
1089432653 11:118436559-118436581 CCCCCCGCCGCCGCCGCCCCCGG - Exonic
1089432710 11:118436684-118436706 GCCGCCGCGGCCGCCACAGCCGG - Exonic
1089466403 11:118689196-118689218 CCCTCCGCAGCCGCTGGCCCGGG + Intergenic
1089543668 11:119206289-119206311 GCCGCCGCCGCCGCCGCCGCCGG - Exonic
1091558583 12:1594166-1594188 GCCGCCGCCGCCGCCGCCTCGGG + Intronic
1092142100 12:6191092-6191114 CCCTCCGCAGCCGCCGGCCCGGG + Intergenic
1092336681 12:7639978-7640000 CCCTCCGCAGCCGCTGGCCCGGG - Intergenic
1092366557 12:7881421-7881443 CCCTCCGCAGCCGCTGGCCCAGG - Intronic
1092572419 12:9739798-9739820 CCCTCCGCAGCCGCTGGCCCGGG + Intergenic
1093034498 12:14320232-14320254 CCCTCCGCAGCCGCTGGCCCGGG - Intergenic
1093652553 12:21661668-21661690 CCCTCCGCAGCCGCTGGCCCGGG - Intronic
1093653939 12:21674274-21674296 CCCTCCGCAGCCGCTGGCCCGGG + Intronic
1093894669 12:24562719-24562741 CCCGCCGCACCCCCCGGGGCGGG - Intergenic
1093970218 12:25369505-25369527 CCCCCCGCAGCCGCTGGCCCGGG - Intergenic
1093972962 12:25391567-25391589 CCCTCCGCAGCCGCTGGCTCGGG - Intergenic
1094041036 12:26122316-26122338 GCCGCGGCTGCCGCCGGGGCGGG + Exonic
1094041122 12:26122642-26122664 GCCGCCGCTGCCGCCGCCGCGGG + Exonic
1095444956 12:42273924-42273946 CCCTCCGCAGCTGCTGGCGCGGG + Intronic
1095752803 12:45729688-45729710 GCCGCCGCCGCCGCCACCGCCGG + Exonic
1096073574 12:48788943-48788965 CCCGCCGCCCCCGCGGGCTCCGG + Intronic
1096116811 12:49059961-49059983 AGCGCCCCGGCCGCCCGCGCCGG + Intergenic
1096191340 12:49622235-49622257 CCCGCAGCCGCCGCCGCGGCAGG - Intronic
1096241398 12:49961980-49962002 CCCGCCGCGGCAGCTGCCGCCGG + Exonic
1096255070 12:50057794-50057816 GCCGCGGCGGCCGCGGGCTCCGG + Exonic
1096495438 12:52037121-52037143 CCCGCCCCGCCCGCCGGGGGAGG + Intronic
1096627374 12:52903969-52903991 CCCGCCCACGCTGCCGGCGCAGG + Intronic
1096796738 12:54082567-54082589 CCGGCCCCGGCCCCCGGCCCCGG - Intergenic
1096983739 12:55743398-55743420 GCCGCCGCCGCCGCCGCCGCGGG - Exonic
1097107698 12:56635033-56635055 CCCTCCGCCGCCGCCGGCCCAGG - Intronic
1097232825 12:57522735-57522757 GCTGCCGCAGCCGCCGCCGCAGG - Exonic
1097264417 12:57737510-57737532 ACCGCCGCCGCCGCCGGGGGAGG - Exonic
1097264423 12:57737516-57737538 GCCGCCACCGCCGCCGCCGCCGG - Exonic
1097264608 12:57738119-57738141 GCGGCCGCGGCCGGCGCCGCCGG - Exonic
1097929629 12:65169837-65169859 CCCGCGGCCGCCGCCGCCGCTGG - Exonic
1097990091 12:65825008-65825030 CCCACCGCCGCCGCCGCCACCGG + Exonic
1098029008 12:66235293-66235315 CGGGCCGCGGCGGCGGGCGCGGG + Intronic
1098029055 12:66235420-66235442 CGCGCGGCGGCGGCCGGCGGGGG + Intronic
1098123824 12:67269639-67269661 GCCGCCGCCGCCGCCGCCACTGG - Exonic
1098168216 12:67719454-67719476 CCCTCCGCAGCCGCTGGCCCGGG + Intergenic
1098498716 12:71166280-71166302 CCCGCCGTGGGCTCCTGCGCTGG - Intronic
1098550373 12:71755140-71755162 CGCCCCGCCGCCGCCGCCGCCGG - Exonic
1098759244 12:74403085-74403107 CCCTCCGCAGCCGCTGGCCCGGG - Intergenic
1099315493 12:81078155-81078177 CCCTCCGAGCCCCCCGGCGCTGG - Exonic
1099716228 12:86296624-86296646 CCCTCCGCAGCCGCTGGCCCGGG + Intronic
1100444816 12:94650580-94650602 CCCTGCGCCGCCGCCGCCGCGGG + Intergenic
1100869441 12:98894977-98894999 GCCGCCGCTGCCGCCAGGGCAGG - Intronic
1101144786 12:101830841-101830863 CGCGCCGCGGCCGCCGCTTCCGG + Exonic
1101150388 12:101877767-101877789 CGCGCCGCCGCCGCCGCCGACGG - Exonic
1101692161 12:107092957-107092979 CCCGCCGCGCCCCCCGGCATGGG - Exonic
1101910474 12:108857362-108857384 CGCGCCGAGGCCGCCGGAGCTGG - Intronic
1102053626 12:109880435-109880457 CCGGCCGCCGCCGTCAGCGCCGG + Exonic
1102136861 12:110582933-110582955 GTCGCCGCCGCCGCCGCCGCCGG + Exonic
1102136863 12:110582939-110582961 GCCGCCGCCGCCGCCGGCCCTGG + Exonic
1102853866 12:116277238-116277260 GCCGCCGCCGCCGCCGGGGGAGG + Exonic
1103146143 12:118597397-118597419 CCCTCCGCAGCCGCTGGCCCGGG + Intergenic
1103348350 12:120265754-120265776 CGCGCGGCGGGCGCGGGCGCGGG - Exonic
1103364016 12:120369340-120369362 CCCGGCGCCGCCGCCTCCGCGGG - Intergenic
1103521248 12:121537911-121537933 GCCGCCGCCGCCGCCGCCGAGGG - Intronic
1103563404 12:121804105-121804127 GCCGCCGCGGCTGCCGGGCCCGG - Intergenic
1103668548 12:122592163-122592185 CCCTCCGCAGCCGCTGGCCCGGG - Intronic
1103764457 12:123271070-123271092 CCATCCGCGCCCGCCCGCGCGGG + Intronic
1103764541 12:123271302-123271324 CGATCCGCAGCCGCCGGCGCGGG + Intronic
1103828731 12:123762219-123762241 CCCGCCGACGGCGCCGGCGCTGG - Intergenic
1104030863 12:125065258-125065280 CGCCCCCCGGCCGCGGGCGCTGG + Intergenic
1104030869 12:125065264-125065286 CCGGCCGCGGGCGCTGGAGCCGG + Intergenic
1104977740 12:132559861-132559883 CCCGCGCCCGCCGCCGGCCCGGG - Intronic
1104985413 12:132593781-132593803 CCCGCCGGGGCCATCGCCGCAGG - Intergenic
1105031410 12:132887159-132887181 CCGGCCCCGGCCCCCGGCCCCGG + Intronic
1105425648 13:20292555-20292577 CCCTCCGCAGCCGCTGGCCCGGG - Intergenic
1106057713 13:26254268-26254290 CCCGCCGCTCCCGCCGCAGCAGG + Exonic
1106516945 13:30464650-30464672 CCGCCCGCGGCCGCCGGGGCCGG + Intronic
1106720149 13:32427989-32428011 GCCGCCCCGGCCGCCCCCGCGGG - Exonic
1107467832 13:40665899-40665921 GCCGCCGCGGCCGCCACCGGGGG - Exonic
1107548964 13:41457735-41457757 CCCGCGGCCGCCGCGGCCGCAGG + Exonic
1107935225 13:45340845-45340867 CCGCGTGCGGCCGCCGGCGCGGG - Intronic
1108247488 13:48532688-48532710 CCTGCCCAGGCCGCCGGCCCAGG - Intronic
1108373416 13:49792536-49792558 GCCGCCGCCGCCGCAGCCGCAGG - Exonic
1108435343 13:50396733-50396755 CCCTCCGCAGCCGCTGGCCCGGG - Intronic
1108541494 13:51451731-51451753 GCCGCCGCCGCCGCCGCTGCCGG + Intronic
1109159871 13:58958404-58958426 CCCTCCGCAGCCGCTGGCCCAGG + Intergenic
1110119758 13:71866530-71866552 GCCGCCGCCGCCGCCGCCGCCGG + Exonic
1110368869 13:74718530-74718552 CCCTCCACAGCCGCCGGCCCGGG - Intergenic
1110999845 13:82165172-82165194 CCCTCCGCAGCCGCTGGCCCAGG + Intergenic
1111602723 13:90494918-90494940 CCCTCCGCAGCCGCTGGCCCGGG - Intergenic
1111951278 13:94711391-94711413 GCAGCGGCGGCCGCCGCCGCCGG - Exonic
1111951317 13:94711550-94711572 GCCGCCGCCGCCGCCGCCGCGGG - Exonic
1112271902 13:97976480-97976502 CCCGCCGCGGCCGCCGGCGCCGG - Intronic
1112505081 13:99970583-99970605 CCCGGCGCCGCCGCCGCCGCCGG - Exonic
1112507813 13:99985446-99985468 GCCGCCGCTGCCGCCGCCGCTGG - Exonic
1113200987 13:107867317-107867339 GCCGCCGCCGCCGCTGCCGCAGG + Intergenic
1113200997 13:107867341-107867363 CCGCCCGCGGGCGCCGCCGCCGG + Intergenic
1113378130 13:109782939-109782961 GCCGCCACCGCCGCCGGCCCCGG - Exonic
1113378530 13:109784443-109784465 ACCGCCGCCGCCGCCGTCTCGGG + Exonic
1113494013 13:110713896-110713918 CACGCCCCGGCCGGCGGCGCAGG - Intronic
1113655910 13:112067731-112067753 CCCGCCGGGGCGGGCGGCGGCGG + Exonic
1113655997 13:112068089-112068111 CGCGCCGCCGCCACCCGCGCCGG - Exonic
1113656100 13:112068502-112068524 GCCGCCGCCGCCGCCGCTGCGGG + Exonic
1113967337 13:114161479-114161501 CCCGCCGCTGTGGCCGCCGCGGG - Intergenic
1114037928 14:18646560-18646582 ACCGCTGCGGCCGCCGCCGCTGG + Intergenic
1114120693 14:19668471-19668493 ACCGCTGCGGCCGCCGCCGCTGG - Intergenic
1114593535 14:23891895-23891917 CCCTCCGCAGCCGCTGGCCCGGG - Intergenic
1114634180 14:24178116-24178138 CTCGCCGCCGCCGTCGTCGCCGG + Exonic
1114634990 14:24182336-24182358 CCAGCCGCGGCTGCCAGGGCAGG + Exonic
1114659112 14:24333732-24333754 CCGGCCGCGGTCCCCGGCTCCGG - Intronic
1114674197 14:24430099-24430121 ACCGCCTCCGCCGCCCGCGCCGG - Intronic
1115028399 14:28767498-28767520 GCCGCCGCCGCCGCCGCCCCCGG + Exonic
1115320741 14:32077122-32077144 CCCGGCGCGGCGGCGGGCGCTGG + Intronic
1115651163 14:35403978-35404000 CCCGCCGGGGCCGCGGGGGGAGG - Intronic
1116152137 14:41154502-41154524 CCGGCCGGAGCCGCCGGCCCGGG - Intergenic
1116251033 14:42482613-42482635 CCCTCCGCAGCCGCTGGCCCGGG + Intergenic
1116310998 14:43326702-43326724 CCGGCCGCCGCCACCGGCCCTGG + Intergenic
1116452363 14:45080575-45080597 CCCTCCGCAGCCGCTGGCCCAGG - Intergenic
1116657924 14:47674740-47674762 CTCGCCGCCGCCGCCGGGGAAGG - Exonic
1117176625 14:53152723-53152745 CCCGCCGCAGCAGCCTCCGCTGG - Exonic
1117183664 14:53217773-53217795 CCCGCCGGCACCGCCGGCCCGGG - Intergenic
1117803120 14:59465005-59465027 CCCGCCAAGGCCGCCGCCACCGG + Exonic
1117920543 14:60722788-60722810 CCCGCAGAGACTGCCGGCGCCGG - Intronic
1118575922 14:67241289-67241311 CTCGCGGCGGCCGCAGGGGCCGG + Exonic
1118607699 14:67515404-67515426 GCCGCCGCCGCCGCCGCCGGGGG - Intronic
1118607703 14:67515407-67515429 GCCGCCGCCGCCGCCGCCGCCGG - Intronic
1119038844 14:71254435-71254457 CCCTCCGCAGCCGCTGGCCCAGG - Intergenic
1119300317 14:73566555-73566577 CCCTCCGCAGCCGCTGGCCCAGG + Intergenic
1120844166 14:89111786-89111808 CCCTCCGCAGCCGCTGGCCCGGG - Intergenic
1121050456 14:90816368-90816390 CCCGCCGCCGCCGCGGGCTCGGG + Exonic
1121127699 14:91418264-91418286 CCCGCAGCTGCCGCCCGCTCTGG + Intergenic
1121368082 14:93332833-93332855 CCCGCCGCTGCTGCTGCCGCTGG + Exonic
1122081490 14:99270631-99270653 CCAGGGGCGGCCGCCGGCTCCGG - Intronic
1122130813 14:99603928-99603950 GCCGCCGCCGCCGTCGCCGCGGG + Exonic
1122183498 14:99971991-99972013 GCCGCCGCCGCCGCCGCCGCCGG + Intronic
1122208372 14:100159638-100159660 CGCGCCGCGGCCGCCGCGACAGG - Exonic
1122270769 14:100567684-100567706 CCCGCCGCAGCGGCCCGGGCCGG + Intronic
1122624162 14:103075669-103075691 CCCTCGGCGGCCGCGGGCGGAGG - Intergenic
1122672945 14:103385808-103385830 CTCGCCTCGGCCGCCGAGGCAGG + Exonic
1122689119 14:103523185-103523207 CTCGCCGCCGCCGCGGGGGCTGG - Intergenic
1122940331 14:104978291-104978313 CCCGCCCCGTGCGCCGGAGCCGG - Exonic
1122975374 14:105168678-105168700 ACCGCCGCCGCCGTCGCCGCCGG - Exonic
1122982160 14:105196782-105196804 CTCCCCGCGGCGCCCGGCGCGGG + Intergenic
1123040187 14:105487224-105487246 CCAGCCGCTGCCGCCTGCACCGG + Exonic
1123671603 15:22664666-22664688 CCCACGGCTGCCGCCGGAGCTGG + Intergenic
1124323642 15:28737891-28737913 CCCACGGCTGCCGCCGGAGCTGG + Intronic
1124500728 15:30225039-30225061 CCCGCCGCCGCCGCCGCCGCAGG + Intergenic
1124628862 15:31326218-31326240 CGCGCCGCGCCCTCCGCCGCCGG - Intergenic
1124742841 15:32313628-32313650 CCCGCCGCCGCCGCCGCCGCAGG - Intergenic
1124929145 15:34101890-34101912 CCGGCCGCCACCGCCGCCGCTGG + Exonic
1125674247 15:41494060-41494082 GTCGCTGCGGCCGCCGCCGCGGG + Exonic
1126088993 15:45034973-45034995 CCCTCCGCAGCCGCTGGCCCGGG - Intronic
1126128079 15:45314231-45314253 CCCTCCGCAGCCGCTGGCCCGGG - Intergenic
1126574249 15:50182236-50182258 ACCGCCGCGGGCTCCGGAGCAGG - Exonic
1126736648 15:51737627-51737649 CCTGCCGAGGCCGCCGGGTCGGG + Exonic
1126767006 15:52019444-52019466 GCCGCCGCCGCCGCCGCCGCCGG - Intronic
1127515508 15:59689359-59689381 CCGGGCGCGGCAGCCGGCGGTGG + Exonic
1127789918 15:62390565-62390587 TCAGCCGCTGCCGCCGCCGCTGG - Intronic
1127931662 15:63601047-63601069 CCCGCCGCTGCCCCCGGGGAAGG + Intronic
1128813306 15:70587396-70587418 CCCTCCGCAGCCGCTGGCCCGGG + Intergenic
1128987348 15:72231027-72231049 CCCGGCGCGCCGGCCGGCCCCGG - Exonic
1129016720 15:72474866-72474888 GCCGCCGCCGCCGCCACCGCCGG - Exonic
1129082531 15:73052849-73052871 GCAGCCGCGGCCGCCTGAGCCGG - Intronic
1129540385 15:76342974-76342996 CCCGTCACGGCCGCCCGCTCTGG - Intergenic
1129592754 15:76931887-76931909 TGCGCCGCCGCGGCCGGCGCCGG + Exonic
1130115483 15:81001651-81001673 CCCGCGACGGCGGCCGGGGCTGG - Exonic
1130115484 15:81001651-81001673 CCAGCCCCGGCCGCCGTCGCGGG + Exonic
1130317651 15:82810041-82810063 CCCGCGGCTGCCGCCGGAGCTGG + Exonic
1130908599 15:88256345-88256367 GCCGCCGCCGCCGCCGCCGCCGG + Exonic
1131097481 15:89665746-89665768 CCCGGCGCGCCCCCCGGCCCGGG - Exonic
1131144295 15:90001573-90001595 CCCGCCGAGGGCCCCAGCGCAGG + Exonic
1131827205 15:96331274-96331296 GCCGCCGCCGCCGCCTGCCCCGG - Exonic
1131846121 15:96492059-96492081 CCCTCCGCGGCCGCTGGCCCGGG + Intergenic
1132055837 15:98649688-98649710 CCCGCAGTGGCCGCGGGCGGCGG - Intronic
1132511019 16:341402-341424 CCCTCCGCAGCCGCTGGCCCGGG - Intronic
1132561881 16:598952-598974 CCAGCAGCAGCCGCCGGCCCCGG - Intronic
1132578754 16:675745-675767 CCGGCCGCGGCCGCCGACCCCGG + Exonic
1132656569 16:1044047-1044069 GCCCCCGCCGCCGCCGGCCCAGG - Intergenic
1132836821 16:1958421-1958443 CCCTCCGCAGCCGCTGGCCCGGG + Intergenic
1132837055 16:1959449-1959471 CCGGCCGCGCCCGGCGGAGCCGG + Intergenic
1133136714 16:3717423-3717445 CCCGGCACGGCCGCCAGCGCCGG + Exonic
1133156453 16:3880137-3880159 CCGGCCGCCGCCGCCGCCGCCGG + Exonic
1133156455 16:3880143-3880165 GCCGCCGCCGCCGCCGGCCGCGG + Exonic
1133156581 16:3880501-3880523 GCTGCCGCCGCCGCCGCCGCCGG + Exonic
1133188364 16:4116063-4116085 CCCCCAGCGCCCGCCGCCGCGGG - Exonic
1133201736 16:4207897-4207919 CCCGCGTCTGCCGCCAGCGCGGG - Intronic
1133212692 16:4272179-4272201 CATGCCGCGGCTCCCGGCGCGGG - Intronic
1133464898 16:6019655-6019677 CCCGCCCCGGCGTCCGGAGCAGG + Intronic
1133784383 16:8963443-8963465 CCCGCGGCGGGCGGCGGCGGCGG + Exonic
1133784411 16:8963567-8963589 GCCGCCGCCGCCGCCGCCGCGGG + Intronic
1133784429 16:8963598-8963620 CCCGCCGCCGGGGCCGGGGCCGG + Intronic
1134438880 16:14285782-14285804 CCTGCTGCGGCCGGCGGGGCGGG - Intergenic
1135597458 16:23755126-23755148 CCCTCCGCAGCCGCCGACGCGGG - Intronic
1135607331 16:23836025-23836047 CGCGCCGCGGCCGCCAGAGCCGG + Exonic
1135751064 16:25059132-25059154 CCCTCCGCAGCCGCTGGCCCTGG + Intergenic
1136226502 16:28863897-28863919 GCCGCCGCCGCCGCCGCCGCCGG + Intronic
1136365370 16:29806904-29806926 CCGGCCGCGGCGGCCCGGGCTGG + Intronic
1136641549 16:31569424-31569446 GCCGCGGCGGCCGCCACCGCAGG + Intergenic
1136724730 16:32348710-32348732 GTCGCCGCGGGCGTCGGCGCCGG - Intergenic
1136784283 16:32925519-32925541 GCCCCCGCCGCCGCCGGCCCGGG - Intergenic
1136843056 16:33554750-33554772 GTCGCCGCGGGCGTCGGCGCCGG - Intergenic
1136885501 16:33928287-33928309 GCCCCCGCCGCCGCCGGCCCGGG + Intergenic
1136891528 16:33975582-33975604 CCGGCCGGGGCCGGGGGCGCGGG + Intergenic
1136993191 16:35169650-35169672 CCCGCCACGGCCGCAAGCCCTGG - Intergenic
1137280494 16:46973060-46973082 CGCCCCGCGGCCGTCGGCCCCGG - Intronic
1137530905 16:49278249-49278271 CCAGGCGCGGCCGCCGGCCCAGG - Exonic
1137655258 16:50153553-50153575 GCCGCCGCCGCCGCCGCCTCAGG - Intronic
1137988483 16:53130524-53130546 CCCGCCGCGGCCGCCACGTCAGG - Intronic
1138178733 16:54928870-54928892 CCCGCCGCAGCCGCAGCCCCTGG - Intergenic
1138185838 16:54976996-54977018 GCCGCCGCCGCCGCCGCCACTGG + Intergenic
1138247622 16:55479275-55479297 GCCGCCGCCGCCGCCGCCGCAGG - Exonic
1139125537 16:64072550-64072572 CCCTCCGCAGCCGCTGGCCCGGG + Intergenic
1139147734 16:64344033-64344055 CCCTCCGCAGCCGCTGGCCCGGG - Intergenic
1140222987 16:73057859-73057881 GCTGCCGCGGCCGCCACCGCTGG - Intronic
1140223212 16:73058542-73058564 GCCGCTGCAGCCGCCGCCGCCGG - Intronic
1140722521 16:77784600-77784622 CCCTCCGCAGCCGCTGGCCCTGG + Intergenic
1140927589 16:79599216-79599238 GCCGCCGCCGCCCCCAGCGCTGG + Exonic
1140927611 16:79599262-79599284 GCCGCCTCGGCCGGTGGCGCTGG - Exonic
1140927672 16:79599469-79599491 CTGGCCGCGGCGGCCGGGGCCGG - Exonic
1141054613 16:80804012-80804034 GCCGCCGCCGCCGCCGCCGCGGG + Intronic
1141054780 16:80804623-80804645 CCCGGCCCGGCCCCCGGGGCGGG + Intergenic
1141079276 16:81036212-81036234 CCCGACGCGGCCGGCGGCCCGGG + Intronic
1141086057 16:81096320-81096342 CCCGCCCCGCCTCCCGGCGCGGG - Exonic
1141465746 16:84204837-84204859 CCCTCCGCAGCCGCTGGCCCGGG + Intergenic
1141538634 16:84700443-84700465 CCCGCCGCGCCGGCCGGGGGAGG + Intronic
1141582727 16:85011329-85011351 GTCGCCGCCGCCGCCGCCGCAGG - Exonic
1141682597 16:85553294-85553316 GCCGCCGCCGCCGCCGCTGCCGG + Intergenic
1142175559 16:88643454-88643476 CCCGCCGCGGCCCCCGGCCGAGG - Exonic
1142186507 16:88697377-88697399 GCCGCCGAGGCCGCCAGAGCAGG - Exonic
1142377154 16:89712012-89712034 CCCGCAGCGGCCCCAGGGGCGGG + Intronic
1203001700 16_KI270728v1_random:169045-169067 GTCGCCGCGGGCGTCGGCGCCGG + Intergenic
1203081504 16_KI270728v1_random:1148024-1148046 CCGGCCGGGGCCGGGGGCGCGGG - Intergenic
1203086940 16_KI270728v1_random:1189525-1189547 GCCCCCGCCGCCGCCGGCCCGGG - Intergenic
1203133304 16_KI270728v1_random:1705451-1705473 GTCGCCGCGGGCGTCGGCGCCGG + Intergenic
1203153221 16_KI270728v1_random:1855048-1855070 GTCGCCGCGGGCGTCGGCGCCGG - Intergenic
1142623729 17:1179930-1179952 CTCGGCGCGGCCGCTGGGGCCGG - Intronic
1142974801 17:3636913-3636935 CCCGCCGCGGCTGAGGGCGCTGG - Intronic
1143099882 17:4499122-4499144 CTCGCTGCGCCCCCCGGCGCCGG - Exonic
1143174615 17:4948984-4949006 CCCGGCGCAGGCGCAGGCGCGGG - Exonic
1143562668 17:7705019-7705041 CCCGCCTCAGCCCCCGGCGCGGG - Intergenic
1144339725 17:14301581-14301603 GCCGCCGCCGCCCCCGCCGCCGG + Exonic
1144724541 17:17495260-17495282 GCCGCCGCCGCCGCCGCTGCCGG + Exonic
1144854079 17:18258500-18258522 CCCGCCCCGGCCGCAGTCCCTGG + Intronic
1145286724 17:21511744-21511766 CGATCCGCGGCCGCTGGCGCCGG + Intergenic
1145765513 17:27456264-27456286 CTCGCCGCGGCCGCCGGGAGGGG + Intergenic
1145925652 17:28644947-28644969 CCCGCCGCCGCCGCCGCCGCCGG + Intronic
1146371134 17:32266153-32266175 CCCGCAGCCGCCGCCGCCCCCGG + Intergenic
1146393606 17:32444480-32444502 CCGGCCGCGGCCGCCGACGCCGG - Exonic
1146492388 17:33292282-33292304 GCCGCCGCTGCCGCCTCCGCGGG + Exonic
1146581195 17:34040114-34040136 CCCGACGCGGCCCCGGGCCCGGG + Intronic
1146740467 17:35279136-35279158 CCCTCCGCAGCCGCTGGCCCGGG + Intergenic
1147015677 17:37489836-37489858 CCCGCCCCGGGCGCGGGCGGAGG + Exonic
1147144574 17:38477666-38477688 GCCCCCGCCGCCGCCGGCCCGGG - Exonic
1147161773 17:38572780-38572802 GCAGCCGCGGCCGCCGCCGCCGG + Intronic
1147200646 17:38799426-38799448 GCCGCCGCCGCCGCCGCCCCGGG - Exonic
1147307401 17:39573630-39573652 GCCGCCGCCGCCGCCGCCGCCGG + Intergenic
1147373625 17:40011073-40011095 CCCTCCGCAGCCGCTGGCCCGGG - Intergenic
1147393128 17:40122214-40122236 CCCGCCCCGGCCCCCCGCCCCGG - Intergenic
1147486428 17:40819137-40819159 GCCGCCGCGTCCGCCGCCTCCGG + Exonic
1147653025 17:42072718-42072740 CGCGCCGCCCCCGCCGGCCCAGG + Intergenic
1147743071 17:42679613-42679635 CCCGCCGCGGCTGCCCCCGCCGG - Exonic
1147943501 17:44066597-44066619 GCAGCCGCGGCCGGCGGCGGCGG + Exonic
1147943503 17:44066601-44066623 GCCGCCGCCGCCGCCGGCCGCGG - Exonic
1147967121 17:44199496-44199518 CCCGGCGCGGCCCCCCGGGCGGG - Intronic
1147967143 17:44199547-44199569 GCCGCCGCCGTCGCCGCCGCCGG - Intronic
1147994790 17:44354674-44354696 GCTGGCGCGGCCGCCGTCGCTGG - Exonic
1148126786 17:45241456-45241478 CCCGACGCGGCCCTCGGCCCTGG + Exonic
1148336038 17:46841950-46841972 CTCGCGGCGGCCGCGGACGCTGG - Intronic
1148490982 17:48023938-48023960 CCCTCCGCGCCCGCCGGCTCCGG + Intergenic
1148698624 17:49575651-49575673 GCCGCCGCCGCCGCCGCCGCCGG + Intergenic
1148698626 17:49575654-49575676 GCCGCCGCCGCCGCCGCCGGTGG + Intergenic
1148714719 17:49707872-49707894 GCCGCCGCTGCTGCCGGTGCCGG - Exonic
1149296275 17:55265033-55265055 GGAGCAGCGGCCGCCGGCGCGGG + Exonic
1149430614 17:56593723-56593745 GCCGCCGCCGCCGCCGCCGCTGG + Exonic
1149430655 17:56593887-56593909 CCCTGCGCCGCCGCCGGCCCGGG + Exonic
1149997448 17:61412409-61412431 CCAGGCGCGGCCGTCAGCGCTGG - Exonic
1150060506 17:62065110-62065132 CCCTCGGCGCCCGCCGGCCCCGG + Intronic
1150108605 17:62479130-62479152 CGGGCAGCCGCCGCCGGCGCCGG - Exonic
1150108609 17:62479136-62479158 CCCGCCCGGGCAGCCGCCGCCGG - Exonic
1150326684 17:64263321-64263343 GCGGCGGCGGCCGCGGGCGCGGG - Intergenic
1150423282 17:65056944-65056966 CCGGCCGCGGCTGCGGGCGCGGG - Intergenic
1150488788 17:65560927-65560949 CCCGACGCCGCGGCCGGCCCGGG - Intronic
1150840379 17:68601010-68601032 CCCGCGGTGGCAGCCGGCGCCGG - Exonic
1150983481 17:70169409-70169431 CCCGCCGCGGTTCCCGGGGCCGG + Intronic
1151674120 17:75589185-75589207 GCCGCCGCCGCAGCCAGCGCAGG - Intergenic
1151755785 17:76074658-76074680 CCAGCAGCGGCCGGCGGCGCTGG - Intronic
1151782676 17:76257869-76257891 CCCTCCGCAGCCGCTGGCCCGGG + Intergenic
1151812546 17:76453020-76453042 TCCGAGGCGGGCGCCGGCGCCGG + Exonic
1152049187 17:77959097-77959119 GCCGCCGCCGCCGCCCGCGCCGG + Intergenic
1152049188 17:77959098-77959120 CCCGGCGCGGGCGGCGGCGGCGG - Intergenic
1152049236 17:77959239-77959261 GCCGCCGCCGCCGCCGGGGACGG + Intergenic
1152361242 17:79834128-79834150 ACCGCCACCGCCGCCGACGCCGG + Exonic
1152543992 17:80991818-80991840 CCCGGCGCGGCCGCCGTAGCGGG + Intronic
1152619051 17:81352269-81352291 CCCTCCGCAGCCGCTGGCCCGGG + Intergenic
1152627361 17:81393776-81393798 CCCGAAGCGGGCGCCGGCGTAGG + Intergenic
1152711208 17:81871217-81871239 CCCGCCCCCGCCGGCGCCGCCGG + Intronic
1152721749 17:81927077-81927099 CTCGCCGCGGACCCCCGCGCCGG + Intronic
1152834380 17:82519886-82519908 GCCGCCGCGGCCGCCGCCATGGG - Exonic
1152924489 17:83080867-83080889 CCCGCCCCCGCCCCCGCCGCGGG + Intronic
1153794399 18:8609486-8609508 GCCGCTGCCGCCGCCGCCGCCGG - Exonic
1154304131 18:13218220-13218242 CCGGCCCCAGCCGACGGCGCAGG - Intronic
1155007510 18:21741527-21741549 GCCGCCGCCGCCGCTGCCGCCGG - Exonic
1155295032 18:24376801-24376823 CCCTCCGCAGCCGCTGGCCCGGG + Intronic
1155297458 18:24397992-24398014 CCCGCCTGGGCCACCGGCGCTGG + Intergenic
1155806304 18:30175339-30175361 CCCTCCGCAGCTGCTGGCGCGGG + Intergenic
1156038671 18:32794713-32794735 CCCTCCGCAGCCGCTGGCCCGGG - Intergenic
1156275817 18:35581797-35581819 CCGGCCGCGACCGCCGCGGCCGG + Intronic
1156411123 18:36829017-36829039 CCCGCAGGGGCCGGCCGCGCAGG + Intronic
1156502065 18:37566293-37566315 CTCCCCGCGGCCGCCGGGCCCGG - Intergenic
1157383816 18:47246660-47246682 CCCGCCCCCGCCGCCGCCCCTGG - Intronic
1157384089 18:47247581-47247603 CCCGCCGGGGCAGCCCCCGCAGG - Intronic
1157384318 18:47248369-47248391 GCCGCCGCGGCCGCGGTGGCCGG - Intronic
1157849133 18:51030705-51030727 GCCGCCGCCGCCGCCGTCGTCGG - Intronic
1157867332 18:51197635-51197657 GCCGCCGCCGCCGCGCGCGCCGG - Intronic
1158351922 18:56572429-56572451 CCCTCCGCAGCCGCTGGCCCCGG - Intergenic
1158435948 18:57435679-57435701 CCCGCCGCCCCCGCCGCCCCCGG + Exonic
1158954159 18:62523598-62523620 GCCGCCGCCGCCGCCGCCCCGGG + Exonic
1159230801 18:65605393-65605415 CCCTCCGCAGCCGCTGGCCCGGG - Intergenic
1159241730 18:65750905-65750927 CCTGCCCCGGCCTCGGGCGCCGG - Exonic
1159656105 18:71031560-71031582 CCCTCCGCGGCCACTGGCCCGGG + Intergenic
1159770502 18:72542196-72542218 CGCGCCGCTCGCGCCGGCGCCGG - Exonic
1159952630 18:74496336-74496358 CCGGCCACGACCCCCGGCGCTGG - Exonic
1160025030 18:75209539-75209561 CCCGGGGCTGCCGCCGGCTCGGG - Intergenic
1160543568 18:79638462-79638484 CCCGGCGCGGACCCCGGCGCTGG - Intergenic
1160653415 19:246536-246558 CGCGCCGCGCCTGCCTGCGCCGG - Intergenic
1160691026 19:460785-460807 CCCCCCGGGCCCGCCGGCTCGGG + Exonic
1160719305 19:590357-590379 CCCGCCTCCTCCGCCGGCCCCGG - Exonic
1160725378 19:615949-615971 GCCGCCGCCGCCGCCGCCGCAGG + Exonic
1160727672 19:624757-624779 CCCGCCGCAGCTGCCGCCCCCGG - Exonic
1160790653 19:921798-921820 CACCTAGCGGCCGCCGGCGCTGG + Intergenic
1160836770 19:1128287-1128309 CCCGCCCCTGCCTCCGGCACAGG - Intronic
1160862158 19:1242014-1242036 CCCTCCGTGGCCGCCGCCCCCGG + Intronic
1160864568 19:1251092-1251114 GCGGCGGCGGCCGCCTGCGCCGG + Intronic
1160894289 19:1395487-1395509 AGCGCCGCCGCCGCCGCCGCCGG + Exonic
1160923891 19:1533827-1533849 CCTCCCGCAGCCGCCGCCGCAGG - Intronic
1161022140 19:2015537-2015559 GCCGCCGCCGCCGCCGCCCCTGG - Exonic
1161063601 19:2227155-2227177 CCCGCCCCGGCCCCCGCCGGAGG + Intronic
1161241156 19:3224699-3224721 CCGCCCGCCGCCGCCGCCGCCGG + Exonic
1161293114 19:3506359-3506381 CCGGCCGCGGCCGCCGCTGACGG - Intronic
1161398002 19:4054811-4054833 GCCGACGCGGGCGCCGACGCCGG - Exonic
1161400703 19:4065458-4065480 GCCACCGCCGCCGCCGGGGCCGG - Intronic
1161400708 19:4065464-4065486 GCCGCCGCCACCGCCGCCGCCGG - Intronic
1161401149 19:4066648-4066670 CCCGGCGCGGCCCCCGGCACGGG - Intronic
1161450711 19:4343873-4343895 CCCGCCGCAGCCCCCCGCCCCGG - Exonic
1161504448 19:4636348-4636370 CCCGCCCCGGCCGCGGGTTCCGG + Intergenic
1161628761 19:5340878-5340900 AGCGCCGCCGCCGCCGCCGCCGG + Intergenic
1161628765 19:5340884-5340906 GCCGCCGCCGCCGCCGGGTCGGG + Intergenic
1161668983 19:5594060-5594082 CCCGCTCCAGCCGCTGGCGCTGG + Exonic
1161677673 19:5661617-5661639 CCCGCTCCAGCCGCTGGCGCTGG - Exonic
1161707266 19:5828026-5828048 CCCGCCGCAGGCGCCGCCGCTGG - Exonic
1161752901 19:6110426-6110448 GCAGCCGCTGCCGCCGCCGCGGG - Exonic
1161802633 19:6424546-6424568 CCCGCCCGGGCCGCCGCCGCCGG + Exonic
1161849739 19:6732155-6732177 CCCACCCCCGCCGCCTGCGCAGG - Exonic
1161911551 19:7198183-7198205 GCCGCCGCAACCGCCGGGGCCGG - Intronic
1162008325 19:7794494-7794516 ACCGCCACGGCCGCAGCCGCAGG - Intergenic
1162030917 19:7916921-7916943 GCCGCCGCCGCCGCCATCGCGGG + Exonic
1162033205 19:7926051-7926073 CGGGCCGCCGCCGCCGCCGCCGG - Exonic
1162128519 19:8511851-8511873 CCCGCCGCCACCCCCGGCCCTGG - Exonic
1162376783 19:10309718-10309740 CCCTCCGCAGCTGCCGGGGCGGG + Exonic
1162733846 19:12734770-12734792 CCCGCCCCCGCTGCGGGCGCTGG - Exonic
1162788643 19:13051821-13051843 CCCGCCGCTGCCGCCTTAGCAGG + Intronic
1162805456 19:13135904-13135926 CCCGCCGTGGCTGCGGGAGCAGG + Exonic
1163106327 19:15125028-15125050 CCCGCGGCCGCCGCCCCCGCTGG - Exonic
1163606978 19:18280982-18281004 GCCGCCGCCGCCGCCGCCGGGGG - Exonic
1163606982 19:18280985-18281007 GCCGCCGCCGCCGCCGCCGCCGG - Exonic
1163807251 19:19406449-19406471 GCCGCCGCCGCCGCCGCCGCGGG - Intronic
1164270585 19:23668748-23668770 CCCTCCGCAGCCGCTGGCCCGGG + Intronic
1164759723 19:30719777-30719799 CCCGCTGCGGCCTCCGGCTCTGG + Intergenic
1164834534 19:31349244-31349266 GCCGCCGCCGCCGCCGCTGCCGG + Exonic
1165157223 19:33796044-33796066 GCCGCCGCGGCGCCCGGGGCTGG - Intronic
1165293063 19:34904863-34904885 CCCGCCGCTGCAGCCGGCCTGGG - Intergenic
1165493945 19:36141118-36141140 GCCGCCGCCGCCGCCGCCCCCGG - Exonic
1165803176 19:38565358-38565380 CGCGCTGGGGCCGCTGGCGCGGG + Exonic
1166036220 19:40170362-40170384 CCCTCCGCAGCCGCTGGCCCAGG + Intergenic
1166045298 19:40226446-40226468 CCTGGCGAGGCCGCCGGGGCTGG - Exonic
1166106689 19:40601241-40601263 CCCCGCGCGGCCGCCGGGGAGGG + Intronic
1166222817 19:41376653-41376675 CCCTCCGCGGCGTCCGGCGAGGG - Exonic
1166361250 19:42253866-42253888 GCCGCCGCCGCCGCCGCCGCCGG + Intronic
1166361254 19:42253869-42253891 GCCGCCGCCGCCGCCGCCGGGGG + Intronic
1166702714 19:44891454-44891476 GCCGCCACCGCCGCCTGCGCCGG + Exonic
1166960539 19:46493765-46493787 TCGGCCTCGGCCGCCCGCGCGGG + Exonic
1167209343 19:48123273-48123295 CCCGGAGCAGCTGCCGGCGCCGG + Exonic
1167258109 19:48443029-48443051 GCCGCCGCGGCCACCGCCGTCGG + Exonic
1167265421 19:48480672-48480694 ACCGCCGCGGCCCCGGGGGCTGG + Intronic
1167309537 19:48729067-48729089 CGCGCCGCAGCCGCCGGCTCGGG - Exonic
1167466142 19:49651902-49651924 CCAGCAGCGGCGGCCGGGGCGGG - Exonic
1167466143 19:49651902-49651924 CCCGCCCCGGCCGCCGCTGCTGG + Exonic
1167501561 19:49851360-49851382 CCCGAGGGGGCCCCCGGCGCCGG - Exonic
1167797487 19:51719372-51719394 CCCACCGCGCCCGCCGCCGCGGG + Exonic
1168019374 19:53597677-53597699 CCCGCCTCGGCCTCCAGGGCTGG + Intergenic
1168064058 19:53909425-53909447 CCGGCCGCCGCCGCCGCCACCGG - Exonic
1168076325 19:53982545-53982567 GGCGCCGCCGCCGCCGCCGCCGG - Exonic
1168280887 19:55304816-55304838 CCCGACGCCACCGCCGGGGCTGG - Exonic
1168287613 19:55342338-55342360 CCTGCCGCGGGCCCCGGCTCTGG - Exonic
1168721770 19:58558394-58558416 GCCGCCGCTGCCGCCGCCGCGGG + Exonic
925084485 2:1097245-1097267 CCCGCCCCGGCCAGCGGTGCAGG - Intronic
925098975 2:1229820-1229842 CCCTCCGCAGCCGCTGGCCCGGG + Intronic
925158535 2:1664906-1664928 CCCTCCGCGGCCACAGACGCAGG - Intronic
925537809 2:4935535-4935557 CCCTCCGCAGCCGCTGGCCCGGG + Intergenic
925912704 2:8583766-8583788 CCTGCTGCAGGCGCCGGCGCGGG - Intergenic
925928169 2:8685356-8685378 CTCCCCGCGGGCGCTGGCGCTGG + Intergenic
926130930 2:10302832-10302854 CCCGCCCCGGCCCCCGCCTCCGG + Intergenic
926217103 2:10912359-10912381 GCCGCCGCCGCCGCTGCCGCTGG - Exonic
926914410 2:17878700-17878722 GCCGCCGCGGCGGCAGGCGCGGG + Intronic
927596572 2:24402957-24402979 CCGGCCAGGGCCGCCAGCGCCGG + Intergenic
927652296 2:24920044-24920066 GCCGCCGCCGCCGCGGGTGCAGG - Intergenic
927929157 2:27033086-27033108 GCCTCCTCGGCCGCCGGCGCCGG - Exonic
927990171 2:27442148-27442170 CCCGCTGGGGCGGCCGGGGCGGG + Exonic
927990170 2:27442148-27442170 CCCGCCCCGGCCGCCCCAGCGGG - Exonic
928493082 2:31803842-31803864 CCCTCCGCAGCCGCTGGCCCGGG - Intergenic
928511773 2:32010090-32010112 CCCGCCGCCGCCGCGGGGCCGGG + Intronic
928606357 2:32947621-32947643 ACCGCCGCCGCCGCCGCCGCCGG + Exonic
928983218 2:37156918-37156940 GCCGCCGCCGCCGCCGCCGCCGG + Exonic
929188786 2:39120983-39121005 GCCGCCGCCACCGCCGCCGCCGG + Exonic
929379688 2:41335729-41335751 CCCTCCGCAGCCGCTGGCCCGGG - Intergenic
929983194 2:46699497-46699519 GCGGCCGCGGACGACGGCGCGGG - Intronic
930358223 2:50346884-50346906 GCCGCCGCCGCCGCCGCCCCCGG + Intronic
930485507 2:52006938-52006960 CCCTCCGCAGCCGCTGGCCCGGG - Intergenic
931253390 2:60551851-60551873 GCCGCCGCCGCCGCCTGCTCCGG + Intronic
931253507 2:60552418-60552440 GCCGCCGCCGCCGCCGCCGAAGG - Intronic
931254109 2:60555284-60555306 GCAGCCGCCGCCGCCGCCGCCGG + Intergenic
931429546 2:62197194-62197216 CCTGCCGGGGCTGCGGGCGCGGG + Intronic
932440371 2:71731085-71731107 CCCGCAGGGGCGCCCGGCGCCGG - Intergenic
932567358 2:72918153-72918175 GCCGCGGCCGCCGCGGGCGCGGG + Exonic
932780208 2:74554634-74554656 CCCCCAGCGGCTGCCGGCGGGGG + Exonic
933487257 2:82938667-82938689 CCCTCCGCAGCCGCTGGCCCGGG + Intergenic
933666741 2:84970945-84970967 CCCGTCGCGACCGCCGGCCGCGG + Intergenic
933666861 2:84971284-84971306 GCCGCCGCCGCCGCCGCCGCGGG + Exonic
933778317 2:85785212-85785234 CCCGCCCAGGCAGCCAGCGCCGG + Intronic
933847419 2:86337255-86337277 CCGCAAGCGGCCGCCGGCGCCGG + Intronic
934031862 2:88055596-88055618 GCCGCCCCCGCCGCCGGGGCGGG + Intronic
934079011 2:88452156-88452178 CCCGCCGCGCCCGCGGGGCCCGG - Exonic
934098227 2:88627144-88627166 GCCGCCTCCGCCGTCGGCGCTGG + Exonic
934933214 2:98445119-98445141 GCCGCCGCGGGGGCCGGGGCCGG + Intronic
935592639 2:104855924-104855946 GCCGCCGCCGCCACCGCCGCAGG + Exonic
935592736 2:104856229-104856251 CGCGCCGCCGCCGCCGCCGCCGG - Exonic
935692616 2:105744882-105744904 GCCGCCGCCGCCGCTGCCGCGGG + Exonic
936122699 2:109760437-109760459 GCCGCCGCCGCCGCCGCCCCCGG - Intergenic
936433260 2:112482222-112482244 CCGGCCCCCGCCGCCCGCGCCGG - Exonic
936581522 2:113704626-113704648 CCCTCCGCAGCCGCTGGCCCGGG + Intergenic
937044990 2:118846554-118846576 GCCGCCGCCGCCGCCGCAGCCGG + Exonic
937119533 2:119432009-119432031 CCCACCGCGAGCGCCGGCGTCGG + Intronic
938273022 2:129992528-129992550 GCTGCCGCCGCCGCCGGCGCTGG - Intergenic
938368844 2:130756268-130756290 CCGGCCGCGGCGCGCGGCGCCGG + Intronic
938443202 2:131353578-131353600 GCTGCCGCCGCCGCCGGCGCTGG + Intronic
938487362 2:131724219-131724241 GCCGCCACCGCCGCCTGCGCCGG - Intronic
939053213 2:137331829-137331851 CCCTCCGCAGCCGCTGGCCCGGG + Intronic
939275206 2:139990921-139990943 CCCTCCGCAGCCGCTGGCCCGGG + Intergenic
939432658 2:142130785-142130807 CCTGCCGCCGCCGCCGCCGCCGG - Exonic
940038041 2:149330494-149330516 CCGGCCGCGGCTGCGGGCGGCGG + Intronic
940666706 2:156618279-156618301 CCCTCCGCAGCCGCTGGCCCGGG + Intergenic
940962201 2:159798131-159798153 CTCGCCGCTGCTGCCGTCGCGGG - Exonic
941020850 2:160407270-160407292 CTCGCCGCCGCCGCCCGGGCCGG - Intronic
941020971 2:160407661-160407683 CGCGCGGCGGCGGCCGGCGGGGG + Intronic
941029314 2:160493444-160493466 GCCGCCGCTGCCGCCGCCGCCGG - Exonic
941095890 2:161239013-161239035 CCCCGCGCGGCCCCCAGCGCCGG + Intergenic
941096686 2:161245164-161245186 CCCGGCGCGGCCGCGGCCGGGGG - Intergenic
941110312 2:161414367-161414389 CCTGCCCAGGCCGCCAGCGCAGG + Intergenic
941119112 2:161507856-161507878 CCCGCCGCCGCCGCCGCCGCGGG + Intronic
941119115 2:161507862-161507884 GCCGCCGCCGCCGCGGGCCCAGG + Intronic
941240085 2:163026414-163026436 CCCTCCGCAGCCGCTGGCCCGGG - Intergenic
941712122 2:168725119-168725141 CCCTCCGCAGCCGCTGGCCCGGG + Intronic
942151070 2:173076167-173076189 CTCGCTCCGGCCGCCGCCGCCGG - Intronic
942241114 2:173964681-173964703 GCCGCCGCCGCCGCCGCCGGGGG - Intronic
942241118 2:173964684-173964706 GCCGCCGCCGCCGCCGCCGCCGG - Intronic
942278090 2:174336938-174336960 GGCGCCGCGGCTGCCGCCGCCGG + Exonic
942450921 2:176107633-176107655 CGCGCCGCCGCCGCCCCCGCCGG - Exonic
942540186 2:177007990-177008012 CCCTCCGCAGCCGCTGGCCCGGG - Intergenic
942867290 2:180691526-180691548 CCCTCCGCAGCCGCTGGCCCGGG - Intergenic
943494753 2:188606616-188606638 CCCTCCGCAGCCGCTGGCCCCGG + Intergenic
943571507 2:189580772-189580794 GCCGCCGCCGCCGCCGCCGTGGG + Exonic
943658583 2:190534531-190534553 CGCGCCGCCGCCGCCGGTCCCGG + Intronic
943680342 2:190761176-190761198 CCCTCCGCAGCCGCTGGCCCGGG + Intergenic
944273141 2:197805130-197805152 CCCGCCGCGTCGGGCGGCGCCGG - Exonic
944412443 2:199457722-199457744 GCCGCCGCCGCCGCCGCCTCCGG - Exonic
944728601 2:202497049-202497071 CCCCCCGCAGCCGCTGGCCCGGG - Intronic
944743729 2:202635607-202635629 GCCGCCGCCGCCGCCGCTGCTGG + Exonic
944831218 2:203535341-203535363 GCCGCCGCCGCCGCCGCCGCGGG - Exonic
945225874 2:207530479-207530501 CCCGCCGCCGCCGCCGGGCCGGG + Intronic
945575476 2:211524599-211524621 CCCTCCGCAGCCGCTGGCCCGGG + Intronic
945948092 2:216013471-216013493 CACGCCGCGGCCGGGGACGCGGG + Exonic
945955417 2:216081874-216081896 CCCGCCCCGCCCGCCGGCCGCGG + Exonic
946404106 2:219483670-219483692 CCCGCAGCAGCCGCTGGCGCAGG - Exonic
946431021 2:219627527-219627549 GCCGCCGCCGCCGCCGCCGCCGG - Intronic
946921291 2:224584755-224584777 CCCGGCGCGGCCGCCCTCCCGGG - Intronic
946982167 2:225229670-225229692 CCCTCCGCAGCCGCTGGCCCGGG + Intergenic
947119453 2:226799946-226799968 CCCTGCGCGGCCGCCAGCTCCGG + Intergenic
947119483 2:226800023-226800045 CCCGCGGCGGGCGCAGGCGGGGG + Intergenic
947418482 2:229921706-229921728 GGCCCCGCCGCCGCCGGCGCCGG + Intronic
947506659 2:230713051-230713073 CGCGCAGCCGCCGCCGCCGCGGG + Exonic
947669141 2:231925784-231925806 CCCCACGCGCCCGCCGGCGCGGG + Intronic
947992133 2:234496604-234496626 CCCGCCGCAGCCGCAGTGGCTGG - Exonic
947992302 2:234497155-234497177 CCCGCCCCGCCCGCCGCCGGGGG + Intergenic
948216716 2:236237820-236237842 GGCGCCGCGGCCGCCGGGGCTGG + Exonic
948449110 2:238058075-238058097 CCCTCCGCAGCCGCTGGCCCGGG + Intronic
948473788 2:238203623-238203645 CCCGCTGCTGCCGCCCGCCCGGG - Exonic
948801583 2:240435737-240435759 CCCCGCGCCGCCGCCGCCGCCGG + Exonic
948824699 2:240568542-240568564 CCCGGCGCGGCCGCCGCCCATGG + Intronic
1168753125 20:297751-297773 CGAGCCGCGGCCGCCGCGGCGGG + Exonic
1169220598 20:3820259-3820281 CCCCTCGCGGCCGCCGGGGTCGG + Intergenic
1169244543 20:4015391-4015413 AGCGCCGCGGCCGCCGCCCCCGG - Intronic
1169278485 20:4248868-4248890 GCCCCCGCCGCCGCCCGCGCTGG + Exonic
1169557620 20:6767689-6767711 GCCGCCGCCGTCGCCGCCGCCGG + Exonic
1170150508 20:13221729-13221751 CCCGGCGCGGCGGCCGGCGGCGG - Intergenic
1170246468 20:14226646-14226668 CCCTCCGCAGCCGCTGGCCCGGG - Intronic
1170756916 20:19212877-19212899 GCCGCCGCCGCCGCCGCCGCCGG + Exonic
1170756918 20:19212880-19212902 GCCGCCGCCGCCGCCGCCGGAGG + Exonic
1170806849 20:19639852-19639874 CCCTCCGCAGCCGCTGGCCCAGG + Intronic
1171896563 20:30814442-30814464 CCCGCCGTGGCCAACGGGGCAGG + Intergenic
1172015431 20:31870261-31870283 CGGGCCGCGGCGGCCGGGGCGGG + Intronic
1172117976 20:32583311-32583333 CCCTCCGCGGCCGCCCGGGCCGG - Intronic
1172118586 20:32585080-32585102 GCCGCCGCCGCCGCCCGAGCAGG - Intronic
1172474491 20:35226777-35226799 GCCGCCGCCGCCGCCGCCGCCGG + Exonic
1172474495 20:35226783-35226805 GCCGCCGCCGCCGCCGGGCCAGG + Exonic
1172587051 20:36092479-36092501 GCCGCCGGAGCCGCCGGAGCTGG - Intronic
1173454159 20:43189992-43190014 GCCGCCGCCGCCGCCCGCCCGGG + Intergenic
1173741638 20:45406319-45406341 CCCGCGGCGGGCGCCCGCGCCGG - Intronic
1173820161 20:46014281-46014303 GCCGCCGCGGCCGCCGGCAGGGG + Intronic
1174287767 20:49484191-49484213 GCCGCCGCCGCCGCGGGAGCAGG - Intergenic
1174287770 20:49484197-49484219 GCCGCCGCCGCCGCCGCCGCGGG - Intergenic
1174357822 20:50010100-50010122 GCCGCCGCCGCCGCCGCTGCCGG - Intergenic
1174380710 20:50153730-50153752 GCCGCCGCCGCGCCCGGCGCTGG - Exonic
1174494667 20:50931112-50931134 GCGGCCGCCGCCGCCCGCGCCGG - Exonic
1175847235 20:62065365-62065387 GCCGCCGCCGCCGTCGCCGCGGG - Exonic
1175847320 20:62065590-62065612 CCGGCCGGAGCCGCGGGCGCAGG - Exonic
1176014933 20:62926214-62926236 GCCGCCGCGGCCTGGGGCGCGGG - Intronic
1176157008 20:63626985-63627007 CCCGACGCCGCCGCCCCCGCCGG - Intronic
1176157095 20:63627295-63627317 CTCGGCCCGGCCGCCCGCGCGGG - Intergenic
1176194607 20:63831385-63831407 CCGGCCGCGGCCACCGCCCCGGG + Intergenic
1176283383 20:64327998-64328020 CCCGCCGCCACCCCAGGCGCAGG - Intergenic
1176380692 21:6111020-6111042 CCCGCCCCCGCCGCCCGGGCGGG - Intergenic
1177011054 21:15730367-15730389 GCCGCCGCCGCCGCCGCCGCGGG + Exonic
1178334670 21:31732280-31732302 GCCGCGGCCGCCGCCGCCGCCGG - Intergenic
1178513836 21:33229904-33229926 CGCCGCGCCGCCGCCGGCGCGGG - Intronic
1178585645 21:33868538-33868560 CCCTCCGCAGCCGCTGGCCCGGG + Intronic
1178914677 21:36699671-36699693 CCCGCCGCCGCAGCCCGAGCGGG + Exonic
1178916674 21:36708934-36708956 CCCGCAGCGGCCGGCAGCCCGGG - Intronic
1178992236 21:37366285-37366307 CCCGCCCCTCCCCCCGGCGCGGG + Intronic
1179561592 21:42219237-42219259 GCCGCCGCCGCCGCCGCCCCCGG + Exonic
1179563947 21:42234865-42234887 TCCGCCGCCACCGCCCGCGCCGG + Intronic
1179605616 21:42513739-42513761 GCCGCCGCGACCCCCGGCTCCGG - Intronic
1179674837 21:42974447-42974469 CCCTGCGCGGCGGCGGGCGCGGG - Intergenic
1179742780 21:43427220-43427242 CCCGCCCCCGCCGCCCGGGCGGG + Intergenic
1179882746 21:44300304-44300326 CCCGCCCCGGCCTCCCGCCCCGG + Intronic
1179882753 21:44300317-44300339 CCCGCCCCGGCCTCCTGCCCCGG + Intronic
1180064340 21:45405140-45405162 CGCGCTGCAGCCGCCGCCGCTGG - Intronic
1180087840 21:45516023-45516045 CCCGCGGCAGCCCCCGGCCCAGG - Exonic
1180110263 21:45644030-45644052 GCCGCCGCAGGCGCCGGCGGCGG - Intronic
1180462055 22:15573602-15573624 ACCGCTGCGGCCGCCGCCGCTGG + Intergenic
1180741042 22:18053578-18053600 CCCTCCGCAGCCGCTGGCCCGGG + Intergenic
1180962037 22:19766500-19766522 GCCGCCGGCGCCGCCGGCCCCGG - Exonic
1180965261 22:19784807-19784829 CCAGCCGCTGCCTCCGGTGCAGG - Exonic
1181026854 22:20131826-20131848 GCCGCCGCCGCCGCCGCCGCGGG + Intronic
1181120863 22:20668241-20668263 TCAGCCGCGGCCTCCGACGCGGG + Intergenic
1182260674 22:29071552-29071574 CCCGCCGCCGCGCCGGGCGCAGG + Intergenic
1182567681 22:31212303-31212325 GCCGCCGCCGCCTCAGGCGCGGG - Intronic
1183452816 22:37906111-37906133 CCCGCCGCCTCCGTCCGCGCCGG - Intronic
1183548507 22:38468028-38468050 GCCAGGGCGGCCGCCGGCGCAGG - Intergenic
1183588945 22:38769000-38769022 CTCGCTGCAGCCGGCGGCGCAGG - Intronic
1183607099 22:38872224-38872246 GCCGCACCGGCCGCGGGCGCAGG - Exonic
1183685241 22:39357738-39357760 CCCTCCGCAGCCGCTGGCCCGGG - Intronic
1183702290 22:39457416-39457438 CCCGCCGCAGCCGCTGCCGCCGG + Exonic
1184033989 22:41910076-41910098 CCCGCGGCAACCCCCGGCGCGGG - Exonic
1184472189 22:44702279-44702301 CCCGGCGGGGCGGCCGGCGCGGG + Intronic
1184796883 22:46738008-46738030 CGCGCCGGGGGCGCCGGCTCCGG + Exonic
1185088125 22:48751718-48751740 CCGGCCCGGGCCGCCGGAGCCGG - Intronic
1185248677 22:49787638-49787660 ACCGCGGAGGCCGCCGCCGCCGG + Intronic
1185313768 22:50170320-50170342 CCCGCCGCCGCCCCCGCCGGAGG + Intergenic
1185333520 22:50261807-50261829 CCCGAGGCGGCCGCCGCCGGGGG + Exonic
1185336178 22:50271783-50271805 GCGGCCGCGGCCGCCGGGGGAGG + Intergenic
1185384610 22:50526103-50526125 CCGGGCGCTGCCGCTGGCGCTGG - Exonic
1185388406 22:50546924-50546946 CCATCCGCCGCCGCCGGCCCCGG - Intergenic
1185409524 22:50674618-50674640 CCCGGCCCGGGCCCCGGCGCGGG + Intergenic
1203238464 22_KI270732v1_random:30911-30933 GCCGCCGCCGCCGCCGCCGCCGG + Intergenic
949970239 3:9397670-9397692 GCCGCCGCCGCCGCCGCTGCCGG + Intronic
950345326 3:12287854-12287876 CCCGGCGCGGGGGCGGGCGCGGG - Intronic
950929397 3:16773855-16773877 CCCTCCGCAGCCGCTGGCCCTGG - Intergenic
951080301 3:18444721-18444743 CCTGCCGCCGCCGCCGCCGCCGG + Intronic
951208321 3:19947260-19947282 GCCGCCGCCGCCGCCGGCGCTGG - Exonic
951208324 3:19947266-19947288 TCCGCCGCCGCCGCCGCCGCCGG - Exonic
951485286 3:23203233-23203255 GCCGCCGCTGCCGCCGCCCCCGG - Intronic
951719801 3:25686860-25686882 CCAGCCGCCGCCGCCAGCACCGG + Intergenic
951981969 3:28575977-28575999 GCCGCCGCCGCCGCCGCCGCCGG + Intergenic
952301268 3:32106553-32106575 TCAGCTGCGGCCCCCGGCGCCGG + Exonic
952355389 3:32578891-32578913 CCCTCCGCAGCCGCTGGCCCAGG - Intergenic
952393715 3:32902933-32902955 CCCTCCGCAGCCGCTGGCCCGGG - Intergenic
952398232 3:32939822-32939844 CCCTCCGCAGCCGCTGGCCCGGG - Intergenic
952593637 3:34988515-34988537 CCCTCCGCAGCCGCTGGCCCGGG - Intergenic
952744450 3:36764221-36764243 CCCGCAGCCGCCGCCGCCCCCGG - Intergenic
952796434 3:37243295-37243317 GCCGCCGCGGCTCCCGGGGCTGG + Exonic
953027531 3:39153564-39153586 CCCGCCGCCGCCGCCGCTGCCGG - Exonic
953124513 3:40078148-40078170 CCCTCCGCAGCCGCTGGCCCGGG + Intronic
953307609 3:41844390-41844412 CCCTCCGCAGCCGCTGGCCCAGG + Intronic
953485090 3:43286967-43286989 CCCGCCGCGGCCGCAAGGGCAGG - Intronic
953908872 3:46882162-46882184 CCCTCCGCAGCCGCCGACGCGGG - Intronic
953909283 3:46883508-46883530 GCAGCCGCCGCCGCCGGCCCTGG - Exonic
954540714 3:51391569-51391591 CCCGCCGCTTCCGCTGCCGCGGG - Exonic
954615554 3:51967340-51967362 GCCGCCGCCGCCGCCGCCGCAGG - Exonic
954618629 3:51983386-51983408 GCCGACGCGGCCGCTGGCGCCGG + Exonic
955186428 3:56719071-56719093 CCCTCCGCAGCCGCTGGCCCGGG - Intergenic
955210286 3:56934604-56934626 CCCTCCGCAGCCGCTGGCCCGGG - Intronic
955228460 3:57079367-57079389 ACCCCCGCGGGCGCCGGAGCCGG + Intergenic
955387610 3:58492063-58492085 GCCGCCGCCGCCGCCGTCGCCGG + Intergenic
955911574 3:63863959-63863981 GCCGCCGCCGCCGCCGCCGCGGG + Intergenic
956659485 3:71583797-71583819 GCCGCCGCCGCCACCGGCGCTGG - Intronic
956659488 3:71583803-71583825 GCCGCCGCCGCCGCCGCCACCGG - Intronic
956677938 3:71753429-71753451 CCCAGCGCGGGCGCCGCCGCCGG + Intronic
957009182 3:74985347-74985369 CCCTCCGCAGCCGCTGGCCCAGG + Intergenic
957792544 3:84959267-84959289 CCCGCCGGGGCTGCCCGAGCAGG - Intronic
957804906 3:85134082-85134104 CCCTCCGCAGCCGCTGGCCCAGG + Intronic
957830016 3:85504897-85504919 CCCTCCGCAGCCGCTGGCCCGGG + Intronic
958022635 3:88015828-88015850 CCCTCCGCAGCCGCTGGCCCAGG - Intergenic
959705658 3:109336726-109336748 CCCGCCGCTGCTCCCGGCCCGGG - Intronic
960149803 3:114238511-114238533 CCCTCCGCAGCCGCTGGCCCGGG + Intergenic
960227535 3:115185108-115185130 CCCTCCGCAGCCGCTGGCCCAGG + Intergenic
960761673 3:121078775-121078797 CCCTCCGCAGCCGCTGGCCCAGG + Intronic
961698838 3:128726199-128726221 TCCGCCGCTGCCGCCGCCTCAGG - Exonic
961858187 3:129893458-129893480 CCCGCCCCGGACGCTGGCGGCGG - Intronic
962600502 3:136987809-136987831 CCCTCCGCAGCCGCTGGCCCGGG + Intronic
962793990 3:138835005-138835027 GCCGCCGCCGCCGCCACCGCGGG - Intergenic
962809119 3:138946685-138946707 CCCGCCGCGTCCTCGGGCTCGGG + Exonic
962859825 3:139389427-139389449 CCCGCTGCGGCCGCCGCCTCAGG - Intronic
963236741 3:142963701-142963723 GCCGCCGCCGCCCCCGGAGCGGG + Intergenic
963440404 3:145333517-145333539 CCCTCCGCAGCCGCTGGCCCGGG - Intergenic
963862171 3:150323107-150323129 CCCTCCGCAGCCGCTGGCCCGGG - Intergenic
964014380 3:151928294-151928316 CCCTCCGCAGCCGCTGGCCCGGG - Intergenic
964032320 3:152152555-152152577 CCCTCCGCAGCCGCTGGCCCGGG - Intergenic
964974173 3:162599837-162599859 CCCTCCGCAGCCGCTGGCCCAGG - Intergenic
965044134 3:163552543-163552565 CCCTCCGCAGCCGCTGGCCCGGG + Intergenic
965298132 3:166975973-166975995 CCCTCCGCAGCCGCTGGCCCGGG - Intergenic
966182199 3:177197561-177197583 GCCGCCGCCGCCGCCGCCGCGGG - Intergenic
966594205 3:181711785-181711807 CCCCGCGCGGCCGGCGGCGCGGG + Intergenic
966725434 3:183103967-183103989 CCCTCCGCAGCCGCTGGCCCGGG + Intronic
966911420 3:184562256-184562278 GCCGCCGCCGTCGCCGCCGCCGG + Exonic
966915828 3:184583716-184583738 CGCGCCGCCGCAGCCGGCCCGGG + Intronic
967718351 3:192789171-192789193 CCCTCCGCAGCCGCTGGCCCGGG - Intergenic
967849517 3:194071306-194071328 CCTGGCGCGGCCGCCGGCTGTGG - Intergenic
968181596 3:196599258-196599280 CCCTCCGCAGCCGCTGGCCCGGG + Intergenic
968225216 3:196968834-196968856 GGGGCCGCCGCCGCCGGCGCAGG + Intronic
968319063 3:197749821-197749843 CCCGCCCCGCCCGCAGCCGCGGG + Exonic
968372848 4:11405-11427 TGCGCCGCGACCCCCGGCGCTGG - Intergenic
968433824 4:575201-575223 CCCGCCGGCCCCGCCGGCCCCGG + Intergenic
968433826 4:575205-575227 CGCGCCGGGGCCGGCGGGGCCGG - Intergenic
968500933 4:949744-949766 CCCACCGCGGCCCCCAGGGCAGG + Intronic
968659640 4:1793710-1793732 CCCGCCGCCGCCGCCGCCCAGGG - Intronic
968674716 4:1871348-1871370 CCCGCCGCCGCCGCCGCAGCCGG - Intergenic
968701300 4:2059401-2059423 GCCGCCGCCGCCGCCGCCGCGGG + Intergenic
968815163 4:2818209-2818231 CCCGCCATGCCCGCCGGCCCTGG - Exonic
968835882 4:2963878-2963900 GCCGCCGCCGCCGCCTCCGCAGG - Exonic
968965364 4:3766615-3766637 CCCGGCGCTGGCGGCGGCGCTGG + Exonic
969330821 4:6472630-6472652 GCCGCCGCCGCCGCTGTCGCAGG + Intronic
969362357 4:6672863-6672885 CCCTCCGCAGCCGCTGGCCCGGG - Intergenic
970194633 4:13542431-13542453 CCCGCTGCCGCCCCCGCCGCCGG + Exonic
970195211 4:13544907-13544929 ACCGCCGCCGCCGCCGGGGGTGG - Exonic
970649325 4:18159490-18159512 CCCTCCGCAGCCGCTGGCCCGGG + Intergenic
970673166 4:18418559-18418581 CCCTCCGCAGCCGCTGGCCCGGG + Intergenic
970803529 4:20004151-20004173 CCCTCCGCAGCCGCTGGCCCGGG - Intergenic
971195759 4:24471031-24471053 CCCGCCGCGCTCGCCGGCGCTGG - Intergenic
971196155 4:24472739-24472761 GCCGCCGCCGCCGCCTGTGCCGG + Intergenic
971377112 4:26064200-26064222 CCCTCCGCAGCCGCTGGCCCAGG + Intergenic
971639825 4:29117493-29117515 CCCTCCGCAGCCGCTGGCCCGGG - Intergenic
971757562 4:30721979-30722001 GCCGCCGCTGCCGCCGCCTCCGG - Exonic
972321550 4:37977358-37977380 GCCGCCGCCGCCGCCGCCGCCGG + Intronic
972396657 4:38664103-38664125 GCCGCCGCGGCCGCCCGGGCTGG - Intergenic
972686915 4:41360777-41360799 GCCGCCGCCGTCGCCGCCGCAGG - Exonic
972725774 4:41745776-41745798 GCCGCCGCCGCCGCCGCCGCAGG + Exonic
972765789 4:42151698-42151720 GCGGCGGCGGCCGCCGGCACCGG - Exonic
972960614 4:44448266-44448288 CCCGTGGCGGCGCCCGGCGCCGG - Exonic
973308081 4:48675480-48675502 CCCTCCGCAGCCGCTGGCCCGGG - Intronic
973613701 4:52659369-52659391 TGGGCCGCGGCCGGCGGCGCGGG + Intergenic
974047269 4:56908350-56908372 CCCGGCGGGGCCGCCGCCGCCGG - Intronic
974484787 4:62492117-62492139 CCCTCCGCAGCCGCTGGCCCGGG + Intergenic
974827760 4:67152019-67152041 CCCTCCGCAGCCGCTGGCCCGGG - Intergenic
974992872 4:69115465-69115487 CCCTCCGCAGCCGCTGGCCCGGG + Intronic
975342578 4:73258586-73258608 CCCGCCACAGCCGCCACCGCCGG + Exonic
975439953 4:74399285-74399307 CCCTCCGCAGCCGCTGGCCCGGG + Intergenic
975444379 4:74445354-74445376 CCCGCTGCTACCGCCGGCGCCGG + Exonic
975673162 4:76801999-76802021 CCCACCGCGCCCGCCCACGCTGG + Intergenic
976389364 4:84493328-84493350 GCCGCCGCCGCCGCCGCTGCTGG + Exonic
976398526 4:84582966-84582988 CCCGCCCCGCCCCCCGGAGCCGG - Exonic
976406379 4:84664830-84664852 CCCTCCGCAGCCGCTGGCCCGGG - Intergenic
976897683 4:90130866-90130888 CCCGCCTCGGCCTCCTGTGCTGG + Intronic
977257545 4:94757911-94757933 GCCGCCGCCGCCGCCACCGCGGG - Intergenic
977574007 4:98658414-98658436 CGCGCCGAGGCCGCCGGAGCCGG + Exonic
978072534 4:104491317-104491339 GCCGCCGCCGCCGCCACCGCCGG + Exonic
978777206 4:112516022-112516044 CGGGCCGCCGCCGCCGCCGCCGG - Exonic
979033229 4:115678711-115678733 CCCTCCGCGGCTGCTGGCCCCGG + Intergenic
979688590 4:123538056-123538078 CCCTCCGCAGCCGCTGGCCCGGG - Intergenic
980043378 4:127964458-127964480 CCCTCCGCAGCCGCTGGCCCGGG + Intronic
980130065 4:128809970-128809992 GCCGCCGCCGTCGCCGCCGCGGG - Intronic
980227981 4:130012920-130012942 CCCTCCGCAGCCGCTGGCCCGGG - Intergenic
981067203 4:140498001-140498023 CTGGCGGCGGCCGCCCGCGCTGG - Intronic
981270743 4:142845722-142845744 GCCGCCGCCGCCGCCGGCCTGGG - Intronic
981270747 4:142845728-142845750 GCCGCCGCCGCCGCCGCCGCCGG - Intronic
981550601 4:145937743-145937765 GCCGCCGCCGCCGCTGCCGCCGG + Intronic
982679099 4:158408205-158408227 CCCTCCGCAGCCGCTGGCCCGGG - Intronic
982712206 4:158768943-158768965 CGCGCCGCCGCCGCCGCCGTGGG + Intergenic
982712252 4:158769132-158769154 GCCACCGCGGCCGCCGCCCCCGG + Exonic
982863383 4:160481899-160481921 CCCTCCGCAGCCGCTGGCCCAGG - Intergenic
983026100 4:162739680-162739702 CCCTCCGCAGCCGCTGGCCCGGG - Intergenic
983077494 4:163343908-163343930 CCCGCTGCTGCCGCCACCGCCGG + Intronic
983238709 4:165207708-165207730 GCCGCGGGGGCCGCCGCCGCAGG + Intronic
983553054 4:169036056-169036078 CCCTCCGCAGCCGCTGGCCCGGG + Intergenic
983752846 4:171298414-171298436 CCCTCCGCAGCTGCCGGCCCGGG - Intergenic
983940284 4:173529557-173529579 GCCGCCGCCGCCGCCGCCTCCGG + Exonic
983941477 4:173538214-173538236 GCCCTCGCGGCCGGCGGCGCGGG + Intergenic
984238818 4:177193417-177193439 CCCTCCGCAGCCGCTGGCCCGGG + Intergenic
984265658 4:177495731-177495753 CCCTCCGCAGCCGCTGGCCCGGG - Intergenic
984734856 4:183099380-183099402 CGCGACGCGGGCGCCGGCGAGGG - Exonic
984776110 4:183482913-183482935 CCCTCCGCAGCCGCTGGCCCGGG + Intergenic
984888647 4:184473248-184473270 CCCGCCGCGGCCCGCGCCCCGGG + Intronic
984973405 4:185209869-185209891 CCCGCGCGGGCCGCAGGCGCCGG + Intronic
985068423 4:186144919-186144941 CGCGCGGCGGGCGCGGGCGCGGG + Exonic
985129099 4:186723882-186723904 CCGGCCCCGCCCGCCGGCGCCGG + Intronic
985203252 4:187505770-187505792 CCCTCCGCAGCCGCTGGCCCGGG - Intergenic
985403871 4:189616867-189616889 CCCTCCGCAGCCGCTGGCCCGGG + Intergenic
985462548 4:190121162-190121184 TGCGCCGCGACCCCCGGCGCTGG + Intergenic
985493373 5:191841-191863 CCCGCAGCCGCCGGCGGCTCCGG - Exonic
985894351 5:2739888-2739910 CCCGCTGCGGCTTCAGGCGCGGG + Intergenic
985896184 5:2751181-2751203 GACGCCGCCGCCGCCGCCGCCGG - Exonic
986297082 5:6448723-6448745 GCCGCCGCCGCCGCAGCCGCCGG - Exonic
986297120 5:6448810-6448832 CCCGCCGCCGCCGCCACCGCCGG - Exonic
986330464 5:6713471-6713493 GCCGCCGCCGCCGCCGCCGCAGG + Intergenic
986330585 5:6713851-6713873 GCCGCCGCCGCCGCCGCCACCGG + Intergenic
986330588 5:6713857-6713879 GCCGCCGCCGCCACCGGCCCAGG + Intergenic
986402824 5:7396154-7396176 CGCGCAGGGGCCTCCGGCGCGGG - Intergenic
986813659 5:11385160-11385182 GCCGCCGCCGCCGCCGCCGCGGG - Exonic
987258264 5:16179467-16179489 GCCGCCGCCGACGCCGCCGCCGG - Exonic
987476694 5:18399893-18399915 CCCTCCGCAGCCGCTGGCCCGGG + Intergenic
988073504 5:26324600-26324622 CCCTCCGCAGCCGCTGGCCCGGG - Intergenic
988086987 5:26485500-26485522 CCCTCCGCAGCCGCTGGCCCCGG + Intergenic
988177267 5:27743601-27743623 CCCTCCGCAGCCGCTGGCCCGGG - Intergenic
988279553 5:29127843-29127865 CCCTCCGCAGCCGCTGGCCCGGG + Intergenic
988437528 5:31193800-31193822 GCCGCCGCCGCCGCGGTCGCCGG - Exonic
988825299 5:34929659-34929681 GCCGCCGCCGCCGCCGCCGCCGG + Exonic
989178880 5:38556715-38556737 CCCGCCCCTGCCCCCGGCCCCGG + Intronic
989229994 5:39074481-39074503 CCCGCCGCCGTCGCCGCCGAGGG - Intergenic
990345267 5:54865216-54865238 CCCTCCGCAGCCGCCGGCCCGGG - Intergenic
990545296 5:56815850-56815872 CCCGCTGCGTCCGCGGGCTCCGG - Exonic
990955145 5:61332804-61332826 GCCGCCGCCGCCGCCGCCGCGGG + Exonic
990955150 5:61332810-61332832 GCCGCCGCCGCCGCGGGGGCCGG + Exonic
991435907 5:66596841-66596863 GCCGCCGCCGCCGCCGCCGTTGG + Exonic
991676507 5:69094102-69094124 GCCGCCACTGCCGCCGTCGCCGG - Exonic
991676557 5:69094287-69094309 GCCGCCGCCGCCGCCGGGGCCGG - Exonic
992067462 5:73120719-73120741 CGACCCGCCGCCGCCGGCGCAGG - Intronic
992105739 5:73448067-73448089 CCTGCCCCCGCCGCCGGGGCCGG + Exonic
992528079 5:77630563-77630585 GCTGCCTCTGCCGCCGGCGCTGG - Exonic
992530235 5:77645709-77645731 CCCGCCCGGCCCGACGGCGCGGG - Intergenic
992947448 5:81823862-81823884 CCCTCCGCAGCCGCTGGCCCGGG - Intergenic
993328577 5:86569744-86569766 CCCTCCGCAGCCGCTGGCCCGGG + Intergenic
993900507 5:93581272-93581294 GCCGCCGCTGCCGCCGCCGGGGG - Intergenic
993901218 5:93585112-93585134 GGCGCCGCCGCCGCCGCCGCGGG - Exonic
994096343 5:95851307-95851329 CCCTCCGCAGCCGCTGGCCCGGG - Intergenic
994507111 5:100656902-100656924 CCCTCCGCAGCCGCTGGCCCGGG - Intergenic
995106375 5:108381468-108381490 CCCGGCGCGCCCGCCCCCGCCGG - Exonic
995568678 5:113457284-113457306 CCCTCCGCAGCCGCTGGCCCGGG - Intronic
995571697 5:113488355-113488377 GCCGCCGCCGCCGCCGCTGCTGG + Exonic
996404299 5:123090650-123090672 GCACCCGCGCCCGCCGGCGCCGG - Intronic
996435694 5:123430687-123430709 CCCTCCGCAGCCGCTGGCCCGGG - Intergenic
996530382 5:124521720-124521742 CCGGCCGCCGCTGCCGGCCCTGG + Intergenic
996862880 5:128084514-128084536 CCCACTGCCGCCGCCGCCGCCGG - Exonic
997201315 5:132011641-132011663 CGCGCCGCCGCCGCCGCTGCCGG + Exonic
997282227 5:132656388-132656410 TCCTCCGCGGCCTCCGGCGGTGG - Intronic
997319154 5:132963572-132963594 CCCGCCCCGTCCGCTGGCGGCGG + Exonic
997470629 5:134115127-134115149 CTCGCCGCGGGCCCCGGCGCCGG - Exonic
997521538 5:134526880-134526902 CCCGCCGCTCCGGCCGCCGCCGG - Intronic
997560969 5:134846016-134846038 CCCGCCGCGGCCGCCGCGCACGG - Exonic
997585183 5:135039642-135039664 CCCGCCGCGGACTCTGGCTCAGG + Intronic
997965461 5:138352790-138352812 GCCGCCGCGTCCGCCATCGCCGG - Exonic
998491626 5:142551856-142551878 CCCACCCGGGGCGCCGGCGCTGG - Intergenic
999300108 5:150485870-150485892 CCCGCCCCGGCCCCCGCCCCGGG + Intronic
999406184 5:151309332-151309354 CCCTCCGCAGCCGCTGGCCCGGG - Intergenic
1000319030 5:160119163-160119185 CCCGCCGCCACCGCCGCCGCCGG - Exonic
1000329188 5:160194117-160194139 CCCTCCGCAGCCGCTGGCCCAGG + Intronic
1001841531 5:174880767-174880789 CCGGCCGGTGCCGCCGGCCCCGG + Intergenic
1002004634 5:176222245-176222267 CCCTCCGCAGCCGCTGGCGCGGG + Intergenic
1002221745 5:177688375-177688397 CCCTCCGCAGCCGCTGGCCCGGG - Intergenic
1002666773 5:180831185-180831207 CCCGCCGCCGCCGCCGCCTCGGG + Intergenic
1002789374 6:426421-426443 CCCTCCGCAGCCGCTGGCCCGGG + Intergenic
1002927107 6:1611048-1611070 CCCGCCCGCGCCGCCGGAGCAGG + Exonic
1003049415 6:2766049-2766071 CCCGCCGCGGCGGCGGCCGCCGG - Exonic
1003060726 6:2860280-2860302 CCCTCCGCAGCCGCTGGCCCGGG - Intergenic
1003508838 6:6762701-6762723 CCCACCGCAGCCGCTGGCCCAGG + Intergenic
1003624091 6:7727052-7727074 GCTGCCGCGGCCGCCGCCGCCGG + Exonic
1003748010 6:9024406-9024428 CCCTCCGCAGCCGCTGGCCCGGG - Intergenic
1003956680 6:11171205-11171227 CCCTCCGCAGCCGCTGGCCCGGG - Intergenic
1004174560 6:13328512-13328534 GCTGCCGCTGCCGCCGCCGCCGG + Intronic
1004196582 6:13511255-13511277 CCCTCCGCAGCCGCTGGCCCAGG + Intergenic
1004216792 6:13711274-13711296 CCCTCCGCCGCCGCCGCCCCCGG - Exonic
1004395894 6:15246048-15246070 GCCGCCGCCGCCGCCGCCGCTGG + Intergenic
1004486276 6:16069437-16069459 CCCTCCGCAGCCGCTGGCCCGGG + Intergenic
1004689090 6:17976408-17976430 CCCTCCGCAGCCGCTGGCCCGGG + Intronic
1004720485 6:18264325-18264347 CCTGCCGCGGCCGACGGGGGAGG - Intronic
1004906931 6:20244991-20245013 CCCTCCGCAGCCACCGGCCCGGG + Intergenic
1004912634 6:20301392-20301414 CCCTCCGCAGCCGCTGGCCCGGG - Intergenic
1004924053 6:20402374-20402396 GCCGCCGCTGCCGCCGCCCCGGG + Exonic
1005600868 6:27425048-27425070 CCCTCCGCAGCCGCTGGCCCAGG + Intergenic
1005605513 6:27473146-27473168 CCCGCCCCGCACGCCGGCGCCGG + Intergenic
1005707442 6:28469573-28469595 CCCTCCGCAGCCGCTGGCCCGGG + Intergenic
1005978236 6:30816518-30816540 CCCTCCGCAGCCGCTGGCCCGGG + Intergenic
1006137143 6:31902037-31902059 GCCGCCGCCGCCGCGCGCGCGGG - Intronic
1006302353 6:33200322-33200344 GCCGCCGCCGCCGCCGCTGCGGG + Exonic
1006472657 6:34237329-34237351 GCCGCCGCCGCCGCGGGCCCCGG - Intronic
1006472660 6:34237335-34237357 CCCTCCGCCGCCGCCGCCGCGGG - Intronic
1006599102 6:35214109-35214131 CCCGCCGCCGCCGCTGGCAGAGG + Intergenic
1006748898 6:36364452-36364474 CCCTCCGCAGCCGCTGGCCCGGG + Intronic
1007760093 6:44128232-44128254 CCGGCCGCTGCCCCCGGCTCTGG + Intronic
1007784201 6:44270777-44270799 ACCGCCGCCGCCGCCGCCGGCGG - Exonic
1007784203 6:44270780-44270802 GCCACCGCCGCCGCCGCCGCCGG - Exonic
1008038786 6:46774739-46774761 CCCTCCGCAGCCGCTGGCCCGGG - Intergenic
1008284342 6:49629769-49629791 CCCTCCGCAGCCGCTGGCCCTGG + Intronic
1009431576 6:63572330-63572352 CACTCCGCGGCGGCCGCCGCCGG - Exonic
1010199310 6:73269094-73269116 CCCTCCGCAGCCGCTGGCCCGGG + Intronic
1010617388 6:78029943-78029965 CCCTCCGCTGCCGCTGGCCCGGG - Intergenic
1011193937 6:84763641-84763663 ACAGCCGCGGCCGAAGGCGCGGG + Intronic
1011246524 6:85326109-85326131 CCCTCCGCAGCCGCTGGCCCGGG - Intergenic
1011640445 6:89412199-89412221 CCCGCCCCGCCCGCCGGCGGAGG + Exonic
1011643057 6:89433159-89433181 CCCGCCGCGTCCGCCGCCGCAGG - Intronic
1012450636 6:99349765-99349787 CCGGCCGCCTCCGCCGGGGCCGG + Intronic
1012939654 6:105403131-105403153 CTTGCCGCCGCCGCCGCCGCTGG - Intergenic
1013025717 6:106269626-106269648 CCCTCCGCAGCCGCTGGCCCGGG + Intronic
1013106144 6:107028176-107028198 CCCGCCCCTTCCGCCGGCGCCGG - Intergenic
1013210921 6:107986034-107986056 CCCGTCGTGGTCACCGGCGCGGG - Intergenic
1014055889 6:117014895-117014917 CCCTCCGCAGCCGCTGGCCCGGG - Intergenic
1014098240 6:117482789-117482811 TGCGCCGCCGCCGCGGGCGCCGG - Exonic
1014116786 6:117675584-117675606 TCCGCCCCTGCGGCCGGCGCGGG - Exonic
1014137540 6:117907190-117907212 GCCGCCGCCGCCGCCGCCGCCGG + Intergenic
1014137623 6:117907477-117907499 GCCGCCGCCGCCGCCCGCCCCGG - Intergenic
1014230101 6:118893978-118894000 CGCGCGGAGGCCGCCGGCGGCGG - Intronic
1014240745 6:119015464-119015486 CCCTCCGCAGCCGCTGGCCCGGG - Intronic
1014739002 6:125125997-125126019 CCCTCCGCAGCCGCTGGCCCGGG - Intronic
1015148928 6:130018509-130018531 GCCGCCGCCGCCGCCGCTGCCGG - Exonic
1015149219 6:130019840-130019862 CCCGCGGCGGCCGTCCGCGCGGG + Intronic
1016340919 6:143060816-143060838 CCGGGCGCGGGCGCGGGCGCGGG - Intronic
1016923181 6:149316981-149317003 CCCGCGGCGGAGGCTGGCGCCGG - Intronic
1017282124 6:152636832-152636854 CCCGCTGCGGCCGGCGGCCGCGG + Intronic
1017325090 6:153133762-153133784 CCCTCCGCAGCCGCTGGCCCGGG - Intergenic
1017662430 6:156687455-156687477 GCCGCCGAGGCCGCCGCGGCCGG - Intergenic
1017672239 6:156778731-156778753 TCCGCCTCCGCCGCCGCCGCCGG + Exonic
1017672280 6:156778839-156778861 CCCGGCGCGGGCGGCGGCGGCGG + Exonic
1017672281 6:156778840-156778862 GCCGCCGCCGCCGCCCGCGCCGG - Exonic
1017793625 6:157823034-157823056 GCCGCCGCCGCCGCCGCCCCCGG - Intronic
1017839506 6:158210008-158210030 CCCTCCGCAGCCGCTGGCCCGGG + Intergenic
1018013502 6:159692985-159693007 CCCGGCGCGGCGGCTGGAGCGGG - Intronic
1018400331 6:163414610-163414632 GCCGCTGCTGCCGCCGCCGCTGG + Intronic
1018400494 6:163415143-163415165 GCCGCCGCCGCCGCCGCCGCCGG - Exonic
1018545674 6:164933438-164933460 CCCTCCGCAGCCGCTGGCCCGGG - Intergenic
1018613429 6:165663363-165663385 CCCGCCCCGGCCCCGGGTGCAGG - Intronic
1018624644 6:165765506-165765528 CCCTCCGCAGCCGCTGGCCCGGG + Intronic
1019298497 7:291161-291183 CGCGCCGCCGCCGCCGCCGCCGG - Intergenic
1019474247 7:1236432-1236454 GCCGCCGCCGCCGCCGCCGCGGG + Exonic
1019577680 7:1745421-1745443 CCCGCCGCCCCCGCCTCCGCCGG + Exonic
1019577799 7:1745913-1745935 CCTGGCGCCGCCGCCTGCGCAGG - Exonic
1019828332 7:3301615-3301637 CGCGCCGCCGCCGCCGCCACCGG - Exonic
1019983982 7:4641941-4641963 CACGGCGCGGCTGCCGGCGAGGG + Intergenic
1019989560 7:4682263-4682285 GCCGCTGCAGCCGCCGCCGCCGG + Intergenic
1019989655 7:4682570-4682592 GCCGCCGCGGCCACCAGGGCCGG - Exonic
1020099863 7:5388760-5388782 CCCCCCGCGGCCACCCCCGCCGG - Exonic
1020099917 7:5388922-5388944 CCCGCTTCGGCCACCAGCGCGGG + Exonic
1020375349 7:7478765-7478787 CCCTCCGCAGCTGCTGGCGCGGG + Intronic
1020727336 7:11832140-11832162 GCCGCCGCCGCCGCCGCCTCTGG + Exonic
1021163057 7:17299169-17299191 ACCACTGCGGCGGCCGGCGCCGG - Exonic
1021452778 7:20798060-20798082 GCTGCGGCGGCCGCGGGCGCGGG + Intergenic
1021510501 7:21427997-21428019 CGCGGCGCGGGCGGCGGCGCGGG - Intergenic
1021600225 7:22356990-22357012 GCCGCCGCGGCGGCCAGGGCCGG + Intronic
1021686765 7:23193953-23193975 CCCTCCGCAGCCGCTGGCCCGGG + Intronic
1022106200 7:27199641-27199663 CCCGCCGGGCCCGCCGGGCCGGG + Exonic
1022207611 7:28179786-28179808 CCGCCCGCGGCCGCCGGCCCCGG + Intronic
1022375280 7:29806601-29806623 GCCGCCGCCGCCTCCGGCTCCGG - Exonic
1022739726 7:33109417-33109439 GCCGCCGCCGCCGCCGCCGCCGG - Intergenic
1023638419 7:42236481-42236503 GCCGCGGGGGCCGCCGCCGCTGG - Intronic
1023773689 7:43583336-43583358 CCGGCCGCCGCCGCCGCCCCAGG + Exonic
1023801496 7:43838955-43838977 CCTACTGCGGCCGCCAGCGCCGG - Intergenic
1023937232 7:44748746-44748768 CCCGCCCCGAGCGCCGGCTCGGG + Intronic
1023951285 7:44848053-44848075 CCGACCGCCGCCGCCGGAGCCGG + Exonic
1024255486 7:47537257-47537279 CTCTCCGTGGCCGCCGGCCCAGG + Intronic
1024269080 7:47628617-47628639 CCCTCCGCAGCCGCTGGCCCGGG - Intergenic
1024580034 7:50793594-50793616 CGCTCGGCGGCCGCCAGCGCGGG + Intergenic
1024691280 7:51805975-51805997 CCCTCCGCAGCCGCTGGCCCAGG - Intergenic
1024834048 7:53495161-53495183 CCCTCCGCAGCCGCTGGCCCGGG - Intergenic
1026047992 7:66921311-66921333 CCAGACGCTGCCCCCGGCGCGGG + Exonic
1026335898 7:69393967-69393989 CCCTCCGCAGCCGCTGGCCCGGG - Intergenic
1026360504 7:69598234-69598256 CCGGCCGGGGCCGCGGGGGCGGG + Intergenic
1026360872 7:69599747-69599769 GCCGGCGCGGCCGGCGGCGGCGG + Exonic
1026360873 7:69599748-69599770 CCCGCCGCCGCCGGCCGCGCCGG - Exonic
1026512343 7:71037734-71037756 CCCTCCGCAGCCGCTGGCCCGGG - Intergenic
1026596556 7:71738299-71738321 CCCTCCGCAGCCGCTGGCCCGGG + Intergenic
1026968293 7:74453929-74453951 CCCTCCGCCGCAGCCCGCGCCGG + Intronic
1027138196 7:75639191-75639213 GCCGCCGCCGCCGCCTGCCCCGG - Intronic
1027374541 7:77537199-77537221 GCCGCCGCCGCCGCCGCCTCAGG - Intergenic
1027400074 7:77798208-77798230 CCCGCACCGTACGCCGGCGCTGG - Intronic
1027674472 7:81141878-81141900 CCCTCCGCAGCCGCTGGCCCGGG - Intergenic
1028511219 7:91627613-91627635 CCCTCCGCAGCCGCTGGCCCGGG + Intergenic
1028585511 7:92447702-92447724 CCCGCGGGGGCCGCCCGAGCCGG + Exonic
1028621485 7:92833563-92833585 GTCGCCGCCGCCGCCGCCGCCGG + Exonic
1028621486 7:92833566-92833588 GCCGCCGCCGCCGCCGCCGGAGG + Exonic
1029080695 7:97971994-97972016 CCCGCCGCAGCCCCCGGCCCGGG + Intergenic
1029276555 7:99408556-99408578 GCCGCCGCCGCCGCAGCCGCCGG - Exonic
1029640537 7:101816753-101816775 GCCGCCGCCGCCGCCGCCGGTGG - Intronic
1029640538 7:101816756-101816778 CGCGCCGCCGCCGCCGCCGCCGG - Intronic
1029640566 7:101816838-101816860 CCGGCCCCGGCCGCCGCCCCCGG + Intronic
1030599980 7:111582163-111582185 CCCTCCGCAGCCGCTGGCCCGGG + Intergenic
1031378800 7:121060109-121060131 CCCTCCGCAGCCGCTGGCCCGGG - Intronic
1031899436 7:127392848-127392870 CCCGCCGCGGCCGGTGGGGAGGG + Intronic
1032013564 7:128361647-128361669 CCCGGCGAAGCCGCCCGCGCCGG + Exonic
1032021572 7:128409701-128409723 CCCTCCTCGGCCGCCCGCCCCGG + Intronic
1032074566 7:128830335-128830357 CCCGCCGCGCCCGCGGCCCCCGG - Intergenic
1032119316 7:129144955-129144977 CCCGCCGCCGCCACCGCCCCCGG - Exonic
1032194369 7:129780818-129780840 GCCACCGCTGCCGCCGCCGCCGG + Intergenic
1032391284 7:131556712-131556734 CCCGGCCCGGCCGCCGCCGCTGG - Intronic
1033033195 7:137846711-137846733 CCCTCCGCGGCCGCCGGAGCGGG - Exonic
1033390644 7:140924602-140924624 CGCGGCGCCGGCGCCGGCGCCGG + Exonic
1033390646 7:140924609-140924631 CCCGAGGCCGGCGCCGGCGCCGG - Exonic
1034128918 7:148698591-148698613 CTCGCCGCTGCCGGCGGCCCCGG - Intronic
1034128968 7:148698742-148698764 TCCCCCGCGGTCGCCGGAGCCGG + Intronic
1034147255 7:148884210-148884232 CGCGCCGCCGCCGCCGCCGCCGG + Exonic
1034167757 7:149038918-149038940 CCCTCCGCAGCCGCTGGCCCGGG + Intergenic
1034219299 7:149431745-149431767 CCCGCCGCCGCCGCCCGGCCAGG - Exonic
1034342736 7:150368724-150368746 CAGGCCGCGGCCGCGGGAGCCGG + Intronic
1034434718 7:151057936-151057958 CCCGCCCCGTCTGCCCGCGCAGG + Exonic
1034441076 7:151086400-151086422 ACCGCCGCCCCCGCCGGCTCCGG - Intronic
1034441218 7:151086863-151086885 GCCGCCGCCGCCCCCGGCCCCGG - Exonic
1034522720 7:151632575-151632597 CCGAGCGCGGCCGCCGGTGCTGG - Intronic
1034560457 7:151876555-151876577 GCCGCCGCTCCCGCCGGGGCTGG + Exonic
1035169541 7:157009947-157009969 GCCGCCGCCGCCGCCGCCGCTGG - Exonic
1035581041 8:738993-739015 GACGCCGCCGCCGCCGCCGCCGG + Intergenic
1036032713 8:4991677-4991699 CCCCCCGGGGGCGTCGGCGCTGG - Intronic
1036723717 8:11201029-11201051 CCTCCCGCGGCCCCCGGCGCCGG - Exonic
1036755155 8:11466668-11466690 CCCGCCGCCTCCTCCTGCGCGGG + Exonic
1036910628 8:12754874-12754896 CGCCCCGCGGCCGCCGCCTCTGG - Exonic
1036914981 8:12796435-12796457 CCCTCCGCAGCCGCTGGCCCAGG - Intergenic
1037425608 8:18751263-18751285 CCCTCCGCAGCCGCTGGCCCGGG + Intronic
1037535227 8:19817436-19817458 GCCGCCGCCGCCGCCACCGCGGG - Exonic
1037957552 8:23071006-23071028 CCCTCCGCAGCCGCTGGCCCGGG + Intergenic
1037983526 8:23272256-23272278 CCCTCCGCAGCCGCTGGCCCAGG - Intronic
1038039746 8:23714669-23714691 CCCGCGGCGGGCGGCGGCACTGG - Intergenic
1038554187 8:28494773-28494795 CCCCGCGCTGCCGCCGGCTCCGG - Intronic
1038972069 8:32647249-32647271 GCCGCCGCCGCCACCGCCGCTGG + Intronic
1039212816 8:35235801-35235823 CCCTCCGCCGCCGCCTGCGGTGG - Exonic
1039453883 8:37695805-37695827 GCCGCCGCCGCCACCGCCGCTGG - Exonic
1039512816 8:38105356-38105378 CCCGCGGCCACCGCCGGCGCGGG + Exonic
1039875065 8:41578210-41578232 CCCGCCCTTGCCGCCGCCGCGGG - Exonic
1039921460 8:41896784-41896806 TTCGCCGCCGCCGCCGCCGCAGG - Intergenic
1040038833 8:42896740-42896762 GCCGCCGCCGCCGCTGCCGCCGG - Intronic
1041059500 8:54022274-54022296 GCCGCCGCCGCCGCCGCCGCGGG - Exonic
1041552680 8:59119259-59119281 GCCGCCGCTGCCGCCGCCGCCGG + Intergenic
1042155691 8:65841973-65841995 GCCGCCGCCGCCGCCGCCGCCGG + Intronic
1042532864 8:69833000-69833022 GCCGCCGCCGCCGCCGCCGCTGG + Exonic
1043129936 8:76447834-76447856 CCCTCCGCAGCCGCTGGCCCGGG + Intergenic
1043388245 8:79768285-79768307 GCCGCCGCCGTCGCCGTCGCCGG - Intergenic
1043435325 8:80231948-80231970 CCCTCCGCAGCCGCTGGCCCGGG - Intergenic
1045432061 8:102123824-102123846 CCCGCCCCGGGGGCCGGGGCCGG - Intronic
1045432062 8:102123824-102123846 CCGGCCCCGGCCCCCGGGGCGGG + Intronic
1045516294 8:102863626-102863648 CCCGCCGCCGCCGCCGCCGCCGG + Intronic
1045516298 8:102863629-102863651 GCCGCCGCCGCCGCCGCCGGGGG + Intronic
1045738014 8:105318843-105318865 GCCGCCGCCGCCGCCGCCGCTGG - Exonic
1046149348 8:110202791-110202813 CCCTCCGCAGCCGCTGGCCCAGG + Intergenic
1046288905 8:112132831-112132853 CCCTCCGCAGCCGCTGGCCCGGG - Intergenic
1046445338 8:114311490-114311512 CCCTCCGCAGCCGCTGGCCCAGG - Intergenic
1047319811 8:123768670-123768692 GCGGCCCCGGCCGCCGGCCCTGG + Exonic
1047631704 8:126714857-126714879 CCCTCCGCAGCCGCTGGCCCGGG + Intergenic
1048244141 8:132775396-132775418 GCCGCCGCCGCCTCCGCCGCCGG - Exonic
1048345595 8:133572265-133572287 CGCGCCGCAGCCGCCGCCTCCGG - Intergenic
1048553984 8:135457632-135457654 AGCGCGGGGGCCGCCGGCGCTGG + Exonic
1048676964 8:136794021-136794043 CCCTCCGCAGCCGCTGGCCCGGG + Intergenic
1048981170 8:139703915-139703937 GCCGCCGCGCCCGCCGCCCCCGG - Intergenic
1049087638 8:140490735-140490757 CCCTCCGCAGCCGCTGGCCCGGG + Intergenic
1049109709 8:140635398-140635420 CCGGCCCCTGCCGCCCGCGCCGG + Intronic
1049145968 8:141001233-141001255 GCCGCCGCCGCCGCCGGTCCCGG - Intronic
1049145970 8:141001239-141001261 CGCGCCGCCGCCGCCGCCGCCGG - Intronic
1049500313 8:142959616-142959638 CCCTCCGCAGCCGCTGGCCCGGG - Intergenic
1049585301 8:143430161-143430183 CCCCGCGCCGCCGCCGCCGCCGG + Exonic
1049585448 8:143430649-143430671 CTCCCCGCGGCCGCCGCCTCGGG + Intergenic
1049681182 8:143919075-143919097 GCCGCCGTGGCTGCCGCCGCCGG + Exonic
1049746830 8:144266545-144266567 CCCGCGGCGGCCGCAGGAGGCGG + Exonic
1049788589 8:144462816-144462838 GCCGCCGCGGCCACCGACCCCGG + Intronic
1049796856 8:144500953-144500975 TCACCCGCGGCTGCCGGCGCTGG - Exonic
1049828540 8:144685533-144685555 CCCGCCGCTGCAGTCGCCGCGGG + Intergenic
1050552247 9:6758380-6758402 CCGGCCGCGGCCGCAGGGGAGGG + Intronic
1051170175 9:14313785-14313807 GCCGCCGCCGCCGCCGGTGTTGG + Intronic
1051170304 9:14314287-14314309 GCAGCCGCCGCCGCCCGCGCCGG + Intronic
1051383303 9:16480647-16480669 CCCTCCGCAGCCGCTGGCCCGGG - Intronic
1052192790 9:25678178-25678200 CACGCCGCCGCCGCCGCCGCTGG + Exonic
1052362157 9:27573213-27573235 GCCGCCGCCGCCGCCGCCGCCGG + Intronic
1052362215 9:27573449-27573471 GCCTCCGCCGCCGCGGGCGCAGG + Intronic
1053114608 9:35490118-35490140 GCCGCCGCCGCCGCCGCCGCCGG + Intronic
1053306215 9:36986352-36986374 CCCGCCGCGGCCGCGCCGGCGGG + Intronic
1053434833 9:38068016-38068038 CCAGGTGCGGCCGCCCGCGCAGG + Exonic
1053812038 9:41862619-41862641 CCCTCCGCAGCCGCTGGCTCAGG + Intergenic
1054175049 9:61869176-61869198 CCGGCCCCGGCCCCCGGCCCCGG - Intergenic
1054618557 9:67324820-67324842 CCCTCCGCAGCCGCTGGCTCAGG - Intergenic
1054662488 9:67711617-67711639 CCGGCCCCGGCCCCCGGCCCCGG + Intergenic
1054775654 9:69121685-69121707 GCCGCCGCGGCCGGCGGTGTCGG - Intronic
1054835570 9:69672286-69672308 GCCGCCGCCGCCGCCGCCGCCGG + Exonic
1055091117 9:72365283-72365305 CCCGCCGCCGCCGCCGCCGCCGG - Intergenic
1056078170 9:83062625-83062647 CCCTCCGCGGGGGGCGGCGCCGG - Exonic
1056643404 9:88388987-88389009 CCCGCCCCCGTCGCCGGCCCGGG - Intronic
1056743748 9:89282565-89282587 CCCTCCGCAGCCGCTGGCCCGGG - Intergenic
1056773941 9:89498043-89498065 CCAGCCGCCGCTGCCGCCGCCGG - Intronic
1057489145 9:95508368-95508390 GCCGCCGCCGCCGCCGCCGCGGG + Exonic
1057883086 9:98807890-98807912 CATGCCGCGGCCGCCGGTGCCGG + Exonic
1058885849 9:109320725-109320747 CCCGCGCAGGCCGCCGGCCCGGG - Exonic
1058885942 9:109321021-109321043 GCCGCCGCCGCCGCTGCCGCCGG + Intergenic
1059633937 9:116154346-116154368 GCCGCCGCCGCCGCCGCCGCCGG + Exonic
1059633955 9:116154394-116154416 CCCGCTGCTGCCGCCGCCGGGGG - Exonic
1060389890 9:123268525-123268547 GCCGCCGCAGCCGCCGCCGCTGG - Intronic
1060514582 9:124257940-124257962 GCCGCCGCCACCGCCTGCGCGGG - Intronic
1060554931 9:124503397-124503419 CCCGCGGCGTCCGCCTGCGGAGG + Exonic
1060700938 9:125748014-125748036 GCGGCCGCGGGAGCCGGCGCCGG - Intronic
1060713081 9:125889935-125889957 GCAGCCGGGGCCGCCGGCGCGGG - Intronic
1060770154 9:126326742-126326764 CCCGCCGCCGCGGCCCGCGGAGG + Intergenic
1061015946 9:127980840-127980862 TCCGCCGGGGCCCGCGGCGCGGG - Intergenic
1061095840 9:128456412-128456434 CCCGCCCCGCCCACCGGCGCGGG + Exonic
1061196660 9:129110567-129110589 CGCGCCGCCGCCGCCGCGGCTGG + Exonic
1061293507 9:129665537-129665559 CCCACCCCGGCTGCTGGCGCTGG - Intergenic
1061450195 9:130663551-130663573 GCCGCAGCGGCCGTCGGGGCTGG - Intergenic
1061828507 9:133275786-133275808 CCCGGCGCGGGCGCCGGAGGGGG - Intergenic
1062155363 9:135045332-135045354 CCCGCCGCGGCCCACACCGCAGG - Intergenic
1062305764 9:135906706-135906728 CCCGCCGCCGCCGCCGCCAACGG + Intronic
1062305840 9:135906934-135906956 CCGGCCGCGTCCCCCGGCCCCGG + Intronic
1062314796 9:135961342-135961364 CCCGCCGCCGCAGCAGCCGCCGG + Exonic
1062325794 9:136011927-136011949 CCCGCCGCGTTCGCAAGCGCTGG - Exonic
1062341405 9:136095298-136095320 CGCGGTGCGGCCGCCGGTGCTGG - Intergenic
1062452611 9:136621875-136621897 CCACCTGCGGCGGCCGGCGCTGG - Intergenic
1062460103 9:136659424-136659446 CCAGGCGCGGCCGCGGGAGCCGG - Exonic
1062592740 9:137281379-137281401 CCCTCCGGGGACACCGGCGCTGG - Exonic
1062659136 9:137619185-137619207 GCCGCCGCTGCCGCCGCCTCAGG + Intronic
1203376602 Un_KI270442v1:382420-382442 CCCGCCGTGGCCAACGGGGCAGG - Intergenic
1186496375 X:10015309-10015331 GCCGCCGCCGCCGCCGCTGCCGG - Intergenic
1186496506 X:10015721-10015743 CGCGCCGCCGCCGCGGGCCCGGG + Exonic
1187067462 X:15854722-15854744 TTCGCCGCCGCCGCCGCCGCCGG - Exonic
1187139047 X:16575592-16575614 CCCTCCGCAGCCGCTGGCCCGGG - Intergenic
1187518154 X:19990952-19990974 GCCGCCGCCGCCGCCGCCGCCGG + Intergenic
1187648294 X:21374030-21374052 CCCGCCGTGGCCGCCACCGCCGG + Intergenic
1187826178 X:23334758-23334780 GCCGCCGTCGCCGCCGCCGCGGG + Exonic
1188005474 X:25013427-25013449 CGTGCCGCCGCCGCCCGCGCTGG - Exonic
1189137119 X:38561513-38561535 GCCGCCGCCGCCGCCGCCGCCGG + Exonic
1189398942 X:40647332-40647354 GCCGCCGCGGCAGACGGCGCGGG + Exonic
1189399002 X:40647608-40647630 GGCGTCGCTGCCGCCGGCGCAGG - Intergenic
1189534514 X:41923175-41923197 CCCGGCGCGGGCGGCGGGGCCGG + Intronic
1189534515 X:41923176-41923198 CCCGGCCCCGCCGCCCGCGCCGG - Intronic
1190413968 X:50163552-50163574 CCCTCCGCAGCCGCTGGCCCGGG + Intergenic
1191618637 X:63192793-63192815 CCCTCCGCAGCCGCTGGCCCAGG + Intergenic
1192361754 X:70445113-70445135 ACCACCGCCGCCGCCGCCGCCGG - Exonic
1192533718 X:71911064-71911086 CCGGCCGCGGGCGCGGGCGCAGG - Intergenic
1192546464 X:72018611-72018633 CCCGCACCGGCCGCCCTCGCAGG - Intergenic
1194977594 X:100409721-100409743 GCCGCCGCCGCCGCCGCCGCGGG + Exonic
1196707342 X:118727688-118727710 CCCGCCCCCGCCCCCGCCGCCGG - Exonic
1197376804 X:125690802-125690824 CCCTCCGCAGCCGCTGGCCCGGG + Intergenic
1198276332 X:135098371-135098393 TCCGCGGCCGCCGCCGCCGCCGG + Intergenic
1199500389 X:148500732-148500754 CCCGCCGCCGCTGCCGCCGCCGG + Exonic
1199736866 X:150693540-150693562 CCCGCCGCCGCCGCCGCCGCCGG - Exonic
1199772836 X:150984713-150984735 CCCGCCCGGGCCGCCGCTGCGGG + Intronic
1199772835 X:150984713-150984735 CCCGCAGCGGCGGCCCGGGCGGG - Intronic
1200231028 X:154443988-154444010 CCCGCCCCAGCCCCCGCCGCCGG - Intergenic
1200277865 X:154751165-154751187 GCCGCCGCGGCCCCCGGGGAGGG + Intronic
1200787719 Y:7274328-7274350 TCCGCCGCGGCCGCCTGGGCCGG - Intergenic
1201285484 Y:12375231-12375253 CCCTCCGCAGCCGCTGGCCCGGG + Intergenic
1201423045 Y:13820427-13820449 CCCTCCGCAGCCGCTGGCCCGGG + Intergenic
1201573031 Y:15433983-15434005 CCCTCCGCAGCCGCTGGCCCAGG - Intergenic
1202137100 Y:21676885-21676907 CCCTCCGCAGCCGCTGGCTCGGG + Intergenic