ID: 1112274376

View in Genome Browser
Species Human (GRCh38)
Location 13:98002589-98002611
Sequence AAATATTTACTGGTACTTAC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 219}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112274376_1112274378 8 Left 1112274376 13:98002589-98002611 CCTGTAAGTACCAGTAAATATTT 0: 1
1: 0
2: 2
3: 17
4: 219
Right 1112274378 13:98002620-98002642 ATGATTAGTGTAGCTTCATGTGG 0: 1
1: 0
2: 1
3: 6
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112274376 Original CRISPR AAATATTTACTGGTACTTAC AGG (reversed) Exonic
906700403 1:47853321-47853343 CAATATTTGCTGGTACATATTGG + Intronic
907227449 1:52961251-52961273 GAATAGTTACTGGCACATACTGG + Intronic
907821019 1:57969175-57969197 AAAAATTTCATGGTTCTTACAGG - Intronic
909452790 1:75817264-75817286 GCATCTTTTCTGGTACTTACTGG - Intronic
909902365 1:81153845-81153867 AAATATCTAGAGGTTCTTACAGG + Intergenic
910045501 1:82908863-82908885 AAATATTTAAAGGTACTTCTTGG + Intergenic
912637523 1:111311884-111311906 AATTATAAACTGGTACTCACTGG + Intronic
917203976 1:172549202-172549224 ACATAATAATTGGTACTTACTGG + Intronic
917986917 1:180330007-180330029 GAATATATACTGTTACTTTCTGG - Intronic
918028667 1:180780416-180780438 AAATATTTTCATGTACTTATTGG + Intronic
919675120 1:200374501-200374523 AAATATTCACAGGAATTTACAGG + Intergenic
920860977 1:209706508-209706530 AAATATTTTCTGGAACTTGGTGG - Intronic
921807022 1:219466829-219466851 AAATATGTACTAGTTTTTACTGG - Intergenic
923841070 1:237670765-237670787 AAATATTTGCATATACTTACTGG + Intronic
924370385 1:243341760-243341782 AAATGTTTAATGGTCTTTACTGG + Intronic
924403420 1:243715222-243715244 AAATTATTAGTGGTACTTTCTGG - Intronic
1063285690 10:4685373-4685395 AAATATTGACTGGCACCTACTGG - Intergenic
1064652904 10:17527291-17527313 AAATATTTTCTGTTTCATACTGG - Intergenic
1064731907 10:18339717-18339739 AAATGTTTATTGGAACATACGGG - Intronic
1066629246 10:37442338-37442360 TAATTTTTATTGGTATTTACTGG + Intergenic
1068392798 10:56420711-56420733 AAATGTTGATTTGTACTTACTGG - Intergenic
1071100815 10:82035608-82035630 AAATATTTCCTATGACTTACTGG + Intronic
1074807578 10:117068761-117068783 AAATATTTACAAATATTTACAGG + Intronic
1077829504 11:5849971-5849993 AAATATTTACAGTTATTGACTGG + Intronic
1078733125 11:13994079-13994101 AAATATTTAGTGGCATTTAATGG + Intronic
1079669449 11:23149102-23149124 AAATAATTACTTGTACTTTCCGG - Intergenic
1080126144 11:28736213-28736235 AAATATTGATTGGTTATTACAGG - Intergenic
1081052048 11:38353820-38353842 ATTTATTTACTGGTTCTAACAGG + Intergenic
1081515787 11:43827812-43827834 AAATATTTACTAGTATTTACTGG - Intronic
1083286603 11:61663404-61663426 ACATCTTTTCTTGTACTTACTGG - Intergenic
1083534822 11:63457944-63457966 AAACTTTTACTGTTATTTACGGG - Intergenic
1086240404 11:84683380-84683402 AAGAATTTACAGGTACATACAGG - Intronic
1086796150 11:91105344-91105366 ATATGTTTACTGTTATTTACAGG + Intergenic
1090694911 11:129230197-129230219 AAATAATTACTGTAACATACAGG + Intronic
1092301962 12:7259783-7259805 AACTATTTCCTGGTATTTCCTGG - Intergenic
1093943330 12:25080043-25080065 AAAGATTGACTGGAATTTACTGG + Intronic
1094138287 12:27152387-27152409 AAATATTTGATGGTACATAAGGG - Intergenic
1095069468 12:37823206-37823228 AAATATCTTCTGATACATACTGG + Intergenic
1095421319 12:42027473-42027495 AAATATTTACTGTTCATTATGGG - Intergenic
1095809985 12:46363026-46363048 AAATAACTACTGGTACTGTCAGG + Exonic
1098753274 12:74323543-74323565 AAATATTTAAGGATACTTTCAGG + Intergenic
1098775448 12:74608754-74608776 AAATATTTATTGCCACTTGCAGG + Intergenic
1100448951 12:94686977-94686999 AAATATTCTATGGTATTTACTGG + Intergenic
1100622736 12:96294962-96294984 AGATATTTATTAGTACTTCCAGG - Intronic
1102154465 12:110713574-110713596 AAATATTGGCTGCTACATACAGG - Intergenic
1103531492 12:121605413-121605435 AAAAATATACTAGTACTTTCAGG - Intergenic
1105534298 13:21249753-21249775 AAAGATGTACTGTCACTTACTGG - Intergenic
1106100607 13:26692694-26692716 AAATATTTACTTTTAATTATTGG + Intergenic
1106735458 13:32584613-32584635 AAATATTTACTGAGGCTTCCAGG + Intergenic
1109158599 13:58943882-58943904 AAATATTTACAGCCTCTTACTGG + Intergenic
1109650643 13:65320944-65320966 AAATATTATATGATACTTACAGG - Intergenic
1109816140 13:67587869-67587891 AATAATTTACTGATACTTAGTGG + Intergenic
1111269399 13:85861448-85861470 AAATAATAACTGATATTTACTGG + Intergenic
1111875726 13:93893042-93893064 AAAAATTTAATGGTTATTACTGG - Intronic
1112274376 13:98002589-98002611 AAATATTTACTGGTACTTACAGG - Exonic
1112895989 13:104301438-104301460 AATTGTTTACAAGTACTTACAGG - Intergenic
1113214225 13:108019368-108019390 AAATATATACTGGTTTTTAAAGG + Intergenic
1115051039 14:29063689-29063711 GAACATTTAGTGGTACTTTCTGG - Intergenic
1120164443 14:81181249-81181271 AAATAATTAGTGTGACTTACTGG - Intronic
1120587480 14:86331159-86331181 AAATATTTCCTGTTATTTAGTGG - Intergenic
1121357243 14:93225839-93225861 AGATATTTCCTTTTACTTACGGG + Intronic
1124011443 15:25842430-25842452 AATTATTTACTTGTAATCACGGG + Intronic
1124804586 15:32868843-32868865 AAATATTTAATGAGACCTACTGG + Intronic
1127163209 15:56213851-56213873 AAATATATACTTGTTTTTACAGG - Intronic
1127354691 15:58187027-58187049 GAATATTGACTGGTTGTTACTGG - Intronic
1129491999 15:75936547-75936569 AAATATTAAGTGATACTTATTGG - Exonic
1129578079 15:76775352-76775374 AAATATTTATTATTACTCACTGG - Intronic
1131691170 15:94829513-94829535 AAATATTTAATGCTATTTCCTGG - Intergenic
1131878701 15:96839067-96839089 AAACATTTACTTATGCTTACTGG - Intergenic
1131950841 15:97680245-97680267 AAATGTTTATTGATACTGACTGG - Intergenic
1133914899 16:10100769-10100791 AAATATTTACTTACACTTTCTGG - Intronic
1137882520 16:52066274-52066296 AAATATTTACATGTATTTTCTGG + Intronic
1138956172 16:61972798-61972820 AAATAGTTGCTGGCACCTACAGG - Intronic
1139052594 16:63144473-63144495 AAGCATTTACTGATCCTTACAGG - Intergenic
1140209075 16:72957056-72957078 GAATATTTACTGAAACTTACAGG - Intronic
1140414673 16:74765857-74765879 AAATATTTATTAGTACCTATTGG + Intronic
1140600799 16:76472780-76472802 CAACACTTACTGGGACTTACTGG + Intronic
1140949619 16:79804161-79804183 AAACATATACTGGCATTTACAGG + Intergenic
1141087373 16:81105963-81105985 AAGTACTTACTGGTACTTATAGG - Intergenic
1144349511 17:14381568-14381590 AAATATTTACTTATACTTGCTGG - Intergenic
1146090525 17:29873149-29873171 AAATATCCACAGTTACTTACGGG + Intronic
1147939434 17:44035576-44035598 AAATATTTTCTGCTTCTTGCAGG - Exonic
1148624086 17:49055493-49055515 AAATCTTGACTGGCACTTCCCGG + Exonic
1149086369 17:52722048-52722070 AAATGTTTCCTGGTACTTCTGGG - Intergenic
1151473180 17:74330609-74330631 AAATATTAACTGGTGCTGATGGG + Intronic
1153980807 18:10308347-10308369 AAGTATTGTGTGGTACTTACAGG + Intergenic
1154467581 18:14664191-14664213 AATTATTAACTGATGCTTACTGG + Intergenic
1155322986 18:24637237-24637259 AAATATTTACTCTTGCTTGCAGG - Intergenic
1156451658 18:37269920-37269942 GAGTACTTACTGATACTTACGGG + Intronic
1158833698 18:61307860-61307882 AAATATTTCCTGTTACTTTGAGG + Intergenic
1159261688 18:66021641-66021663 AAATATTTTCAAGGACTTACAGG - Intergenic
1160615523 18:80124420-80124442 AAATACTTACTTATATTTACTGG + Intronic
1165002868 19:32779344-32779366 AACCGCTTACTGGTACTTACAGG - Intronic
925044390 2:760942-760964 AAATATTTTTTGGTACTTTGGGG - Intergenic
927385895 2:22533458-22533480 AAGTTTTTACTGTTACTTATGGG + Intergenic
927472808 2:23387641-23387663 AAGTATTCACTAGTGCTTACTGG - Intronic
928625653 2:33137367-33137389 TAATATTTGTTGGTACTTAAAGG + Intronic
928912849 2:36440320-36440342 AAACATTGCCTGGTACTAACTGG + Intronic
928937646 2:36696252-36696274 AATTATATGCTGGTAGTTACAGG - Intergenic
930286675 2:49437618-49437640 AATTATTTACTTCTATTTACTGG + Intergenic
931294377 2:60907214-60907236 AAATATGTACAGGTACTGGCTGG - Intronic
934608470 2:95716412-95716434 AAATATTTATTGATGCTCACCGG + Intergenic
940044020 2:149390378-149390400 AAATGCTCACTGGTTCTTACTGG + Intronic
940235192 2:151503982-151504004 AAATTTTTACTGCTAATTGCTGG + Intronic
940477434 2:154181645-154181667 AAATATTTACTGGATCTCATAGG + Intronic
940737236 2:157467251-157467273 AAATATTTCCGGCTACTTATAGG - Intronic
941108231 2:161387090-161387112 ATATATTTACAGGTTCTAACTGG - Intronic
943666550 2:190615356-190615378 AGATATTTACTTGCATTTACTGG + Intergenic
943799121 2:192035594-192035616 AAATATTTACTGAAAATAACTGG - Intronic
944707638 2:202307403-202307425 AAATATTAATTTGAACTTACTGG + Intergenic
945105082 2:206303914-206303936 AAATAATTAATGGTATTTAATGG - Intronic
1168881845 20:1212925-1212947 AAATATTAACACGTACTCACTGG - Intergenic
1170418788 20:16171751-16171773 AAATGTTAATTTGTACTTACAGG - Intergenic
1173196805 20:40921038-40921060 ATATATTTAATGATACTTAATGG + Intergenic
1174230721 20:49043725-49043747 AAATGATTACTGGTGATTACTGG + Intergenic
1175405833 20:58726694-58726716 AAATATTTACTATTAATAACTGG + Intergenic
1176806931 21:13493487-13493509 AATTATTAACTGATGCTTACTGG - Intergenic
1177006582 21:15680004-15680026 AAATACACACTGGTATTTACAGG + Intergenic
1177063309 21:16398696-16398718 AAATATATCCTGATATTTACAGG + Intergenic
1177696389 21:24578672-24578694 AAATATGTAGGGGTACATACTGG - Intergenic
1178013183 21:28310965-28310987 AAATTTTTACTAATACTAACTGG + Intergenic
1182172180 22:28242732-28242754 AACTAATTACTGGTGCTGACTGG + Intronic
949249116 3:1961401-1961423 CAATAGTAACTGGAACTTACAGG + Intergenic
950275157 3:11654627-11654649 AAATATTTTAAGATACTTACAGG - Intronic
950354467 3:12394290-12394312 ATATAATTCCTGTTACTTACAGG + Intronic
950354469 3:12394334-12394356 ATATATTTCCTGTTGCTTACAGG + Intronic
950711025 3:14812849-14812871 AAATATTAGCTGGTATTTACTGG - Intergenic
951771852 3:26266953-26266975 AAATGTTCACTGGTACTCAAGGG - Intergenic
953248415 3:41219250-41219272 AAATAAATACTGGTACTTCAGGG - Intronic
954956585 3:54526660-54526682 AAATACTTATGGGTACTTAAGGG - Intronic
957270124 3:78019450-78019472 AAATATTTACTGTTGCTTTTTGG + Intergenic
957315189 3:78567673-78567695 ATTAATTTACTGGTATTTACTGG + Intergenic
957687567 3:83522057-83522079 AAATATATAGTTGTACTTCCGGG - Intergenic
957812886 3:85250373-85250395 AAATATTAATAGGTATTTACTGG - Intronic
957814537 3:85277160-85277182 AAATATTAACTGCTAAGTACTGG + Intronic
957961323 3:87257371-87257393 AATGAGTTACTGGTATTTACTGG + Intergenic
958587552 3:96109405-96109427 AAACAATTACTGGAAATTACAGG + Intergenic
958622479 3:96579186-96579208 AAATTTTTAGTGGTCCATACTGG + Intergenic
958662085 3:97082814-97082836 ATATATTTAATCGTATTTACTGG - Intronic
959076903 3:101758932-101758954 TAATATTTACTGGTATTATCAGG + Intronic
959361488 3:105399233-105399255 AAATATTTACTGAAATTTGCTGG - Intronic
959635567 3:108563814-108563836 GAATATTTACATGTACTTACTGG + Intronic
960693261 3:120369603-120369625 AAATATTTACGGCTAGTTACTGG - Intergenic
962112120 3:132463218-132463240 ATATATTTACAGCTACTTAAGGG - Intronic
963984690 3:151578277-151578299 AAATATTTACTATTACTATCTGG - Intergenic
964546160 3:157835861-157835883 AAATCTTTTCTGGTAGTAACAGG + Intergenic
965555717 3:170016547-170016569 ACATCTTTTCTTGTACTTACTGG + Intergenic
965943928 3:174217201-174217223 GAATATTTACTGATACATAAGGG - Intronic
967581601 3:191162857-191162879 GAATATAGACTGGTACTTTCAGG + Intergenic
971229769 4:24791789-24791811 GAAAAATTACTGGTTCTTACTGG + Intronic
971723750 4:30281666-30281688 AAATATTACCAAGTACTTACTGG + Intergenic
972215457 4:36892827-36892849 AAATATTTACTGCTTACTACAGG + Intergenic
973129060 4:46627018-46627040 AAATACTTATTGATAATTACAGG - Intergenic
976923106 4:90462141-90462163 AAATATTTACTGGTTCATTTTGG + Intronic
977392588 4:96430678-96430700 AAATTTTTAATAGTACTTACTGG - Intergenic
977852957 4:101852442-101852464 AAATATTGAGTGGTTCTTTCTGG - Intronic
978292603 4:107162261-107162283 AAATCTTTACTGATTCTTTCAGG + Intronic
980383273 4:132055074-132055096 AAATATTTACTGGAAATTCCAGG + Intergenic
980674707 4:136061449-136061471 TCATATTTACCTGTACTTACTGG + Intergenic
981300227 4:143178568-143178590 AAGTATTTACTGGTGATTATAGG - Intergenic
981332526 4:143528717-143528739 AAGTATTTCCTGGTGCTTTCTGG + Intronic
981645981 4:146999427-146999449 AAATATTTACTTGACCTCACTGG - Intergenic
981825624 4:148937529-148937551 AACTAATAACTGGAACTTACTGG - Intergenic
982006901 4:151072236-151072258 AAATACTTACTTGTACTCAAGGG + Intergenic
982720878 4:158858626-158858648 GAACATGTACTGGTACTTCCAGG - Intronic
983409821 4:167382079-167382101 AAATATTTATTGATGTTTACGGG + Intergenic
983816766 4:172139066-172139088 AAAAATTAACTGTTACTTAGTGG + Intronic
987010977 5:13764326-13764348 AAATATTTTCTGCTGCTTTCTGG - Intronic
987663958 5:20911848-20911870 AAATACCTACTGGTACCTACAGG - Intergenic
988758732 5:34290343-34290365 AAATACCTACTGGTACCTACAGG + Intergenic
990176879 5:53117815-53117837 AAATATTTCCTGGTCTTTATTGG + Intergenic
990877997 5:60508387-60508409 AGATGTTTACTGGTGTTTACTGG - Intronic
992847823 5:80771511-80771533 AATTATTTAGAGGTACTTAAAGG + Intronic
993331725 5:86608598-86608620 AAATATTAACTTATACTTAATGG - Intergenic
993810308 5:92468009-92468031 AAATATTTGCTGATGCTTATAGG - Intergenic
995075579 5:107979439-107979461 AAATAATTACTGGCACTAATGGG - Intronic
997275185 5:132580916-132580938 AGATCTATACTGGTATTTACAGG - Intronic
997311618 5:132889484-132889506 CAACATTTATTGGTAGTTACTGG + Intronic
998651508 5:144126141-144126163 AAAGATTAACTGGTAATGACTGG - Intergenic
999599195 5:153241967-153241989 AAATATATCCTGATACTTTCAGG - Intergenic
1000412687 5:160950065-160950087 AAAGACTCACTGGAACTTACAGG + Intergenic
1000527431 5:162375363-162375385 AAATATTTTCTGGTTTTTATTGG + Intergenic
1000642289 5:163717363-163717385 TCATATTTAATGTTACTTACAGG + Intergenic
1001106751 5:168860941-168860963 GAAAATTTACTGTTACTCACAGG - Intronic
1003376815 6:5587088-5587110 AAAGATGTACTGTCACTTACTGG + Intronic
1004581079 6:16953378-16953400 AAATATTTACTCTTACTTCTTGG + Intergenic
1004972906 6:20931800-20931822 AAATATTTTCAGGTTCTTTCGGG - Intronic
1005248377 6:23915021-23915043 AAGTATTTTCTGCTACTTAGAGG - Intergenic
1010572452 6:77494222-77494244 GAATATCTACTGGTAGTTATAGG + Intergenic
1010716174 6:79233121-79233143 AAATCTTTACTAGTAGTTATTGG + Intronic
1012374624 6:98546814-98546836 AAATATTTACTGTGTCTTTCGGG - Intergenic
1013000140 6:106013715-106013737 GAATCTCTACTGGTACTTATGGG - Intergenic
1013193399 6:107823523-107823545 TAATATTTACTGCTAGTTTCTGG - Intronic
1015078642 6:129195575-129195597 AAATATTCACTGGTACATAGGGG - Intronic
1015252287 6:131139551-131139573 AAATAATTCCTGGTATTTAGTGG - Intronic
1016011364 6:139140595-139140617 AAATATATTCTTGGACTTACAGG - Intronic
1018374894 6:163201595-163201617 AAATATTTACTGGCAGCTACAGG + Intronic
1021415981 7:20385349-20385371 ATATATTCACTAGTATTTACTGG + Intronic
1024752192 7:52479897-52479919 AAATACTTACTTGTGCTAACTGG + Intergenic
1027501699 7:78960006-78960028 AAATATTTACTGATAAATACAGG + Intronic
1027853453 7:83478889-83478911 AAATTCTAACTGCTACTTACTGG + Intronic
1027981421 7:85228468-85228490 AAATATCTACTGGTACACAGTGG + Intergenic
1028482528 7:91323286-91323308 AAATATTTACTAGGGCCTACTGG + Intergenic
1031329735 7:120450114-120450136 AAAAATTTACTGGTTTTCACCGG + Intronic
1034505777 7:151489590-151489612 AAATATTTACTGGTACTGTCTGG - Intronic
1035132125 7:156664935-156664957 AAATTTTTATAGGTACTTAAAGG - Intronic
1036477788 8:9109476-9109498 AAATATTTACTGGCAATTTAAGG - Intronic
1036826953 8:11984561-11984583 AAATATTTACCTATACTGACTGG + Exonic
1039238055 8:35524539-35524561 AAATATTTTCTGCTTCTTGCAGG - Intronic
1040113144 8:43582653-43582675 AAATATTTCCTGATACAAACTGG + Intergenic
1041877203 8:62703403-62703425 AATAATTTAATGGTACATACAGG - Intronic
1043424065 8:80131394-80131416 AAATATTAATTGGTACTCAGAGG + Intronic
1043571241 8:81604473-81604495 AGATATTTATTGGTATTTACTGG + Intergenic
1044107590 8:88230503-88230525 AAATACTTACTGCTAGTCACTGG + Intronic
1045584067 8:103511399-103511421 AAATATTTACTTATTCATACTGG - Intronic
1046107275 8:109681696-109681718 AGATATTTACTGATATATACAGG + Intronic
1046174109 8:110552554-110552576 AAATACTTACTGCTTTTTACAGG + Intergenic
1047271979 8:123369291-123369313 AGATATTTACTAGTACTTCATGG - Intronic
1047552362 8:125888772-125888794 AAATAATTTCTGTTATTTACCGG + Intergenic
1048944843 8:139435422-139435444 GAATATTTATTGGTATTTATAGG - Intergenic
1048951015 8:139496833-139496855 AACTATTTACTGGTAGGTAAGGG + Intergenic
1050616623 9:7407992-7408014 AAATATTTACTGATCCATCCTGG - Intergenic
1051008912 9:12385567-12385589 AAATATTTTGTGTTACTTAATGG - Intergenic
1052221939 9:26034943-26034965 CAGAATTTACTGGAACTTACCGG - Intergenic
1052844314 9:33321702-33321724 AAATGTTTTTTGGTACATACAGG - Intronic
1054770121 9:69075665-69075687 AAATATTCACTGTAACATACTGG + Intronic
1057506846 9:95641334-95641356 AAATATTTAATGGCACATACAGG + Intergenic
1058326353 9:103703317-103703339 GAATATTTACTGCTATTTAGGGG + Intergenic
1203453955 Un_GL000219v1:147491-147513 TAAACTTTACTGGTATTTACTGG + Intergenic
1186243478 X:7594548-7594570 AAATATTTACTGGTTCTCTTTGG - Intergenic
1186399499 X:9243908-9243930 AAATATTTACTATTAAATACAGG - Intergenic
1187462213 X:19497576-19497598 AAATATTTGGTGGGATTTACTGG + Intronic
1188573055 X:31612657-31612679 AAATATTAATTGGTACACACTGG + Intronic
1190792982 X:53717081-53717103 AAACATTTACTGGTCCTTCAAGG + Intergenic
1196180807 X:112687594-112687616 GAATATTTGCTGGGAATTACAGG + Intergenic
1196218047 X:113078533-113078555 AAATATTTTCTGGCTTTTACTGG + Intergenic
1196917486 X:120552489-120552511 GCATATTTACTGGTAATTAGTGG - Intronic
1197388491 X:125829979-125830001 AAATATTTAGTGCTTCTTTCAGG - Intergenic
1201715184 Y:17036777-17036799 ATATATTTACATGTTCTTACAGG + Intergenic